ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB35513.1'
Gene ID: ZHAS_00002280
Protein ID: KFB35513.1
Description: cytochrome P450, CYP 6AG1
Location: KE524560.1:101992:103952:reverse strand[JBrowse]
Sequence: >ZHAS_00002280  (1506 bp)    All exons in this region
ATGTTGCTTACAATCACGCTACTCGTGACAGTGGGAACGCTGGTTTACCTGTTCCTGGCATGGAACGTGAATTACTGGACGAAACGGGGCGTACCAGGGCCAGCCCCACGTTTGGTGTTTGGCAACTTCCCCAGCTTCATCCTGCGCAATCGGCCGTTCGTCGATGACTTCCAGGATATATACAAGTAAGCACGAATGCACCTAAGAAAGATTGTTGTGTCAAAATTCTGATTTTACACATTTTGTGTATTTTTAAACATTTTTTTCCACTCCCATTATGATGGTGCAGTAAGTTTCGCTACCAAGGCAATTTCGTCGGCGTGTTCAATGGCAGAACACCGGCCATTTTGGTACTGAAGCCCGCGCTGCTGAAGGATGTATTGATAAAGAATTTCAAAAACTTTCAAGACAATGAGTTTGCCGACTCGATTAACAAGGAGAGCGATCCCATCTTTGGTCGCAACCCGTTTATGCTGAAGGGCGAGGAGTGGAAGGAGAAGCGGGCCGAAGTAACGCCTGCGTTCACCACCTCGCGGGTATGTGACCGGCTCATTGCATTTCACTGGCAATGAAGATTAATGGTCATATGTTTTTATGTTTGCTTCCCTCAGATGAAGGCTCTCTTTCCTTTCGTTGAGGATGTGACGCAGCGTATGACGCAGTACGTGGTGAAGAATCAGGTCCAGGGACCGATCGAGTCGCGAGAACTCTGTGCCAAATATACGACCGACGTCGTGTCGAGCTGTATATTCGCCGCGGACGCACAATCGTTCTCCAAGGAGAAGGCCGAGATCCGAGAGATGGGTCGCAAGTTGCTCGAGCCCAACTTCCGGATCGTGCTCATGTTCTTGCTGATCGGGCTCGTACCGGCACTGAAGAAACTCTTCCCGATCGCGTTCGTGCCGAAACCGATCGAACAGTTCTTCACCCGGCTAATGGATGACGCCGTGGCCTATCGCGAAAAGAACGGCATCAAGCGCGTCGACTACCTTGACCATCTGATCGGCTTGAAGGCGAGGAAACAGCTGAGCTCGCTGGACATGGCCGCCCACGGGGTGACGTTCTTTATCGACGGATTCGAAACGTCCAGCCTGGCGATGAGCTTCACGCTGTACGAGCTGGCCCGCAATCCGGACTGTCAGGAAAAACTGCGCACTGAACTGCTAGCGGCACGTAACGAGAACGGTACCATAGACTATGACACGCTGCTGGAGCTGCCCTATCTGGACCAAGTTTTAAACGGTAGGTTATTCTATTGAAATATTTTTATGGCAAACATTTTAAGTATTAACAACGAAATCACGTGGCCAAAAAAATAGCAAGTTGGATAATAATGTTTGGTTAATGATGGTGAACTTTGTGCAAAAGTGGTTCTAGTCCGTGCAGTTCTAAATACTCCGACATTATCATCAATACCAATGTGATGCGTAATACGCCTTGCACAAGGAAAAAATCAATGTTTGCTGAGTTCGATTGATTTGTTGTTCATGTAAACTTCGCTTTTTACACGTTTTCTAGAGGCACTTCGACTGTGGCCACCGGCCGCCTTCCTTTCGAAGGTTTGCACCGTACCGACGGAACTCGAGCTTGAAGACGGCGGCCGAAAGGTGTTGATCGAGCGCGGCACTCCGGTGATGCTTCCACTCTGGCAGATTCATCGCGACCAGGAGTACTTCGAGGACGCAGAGCGCTTTAATCCGGCACGGTTTGCACCGGAGTTAGGTGGAACGAAAGCGTACCGCGAGAAGGGATGCTTTGTCCCGTTCGGAGATGGACCACGCCAGTGTCTGGGCATGCGATTCGCTCTGATGCAGGTCAAGCGGGGCATTTACGAGCTCGTGACCAAGTACAACATTTCCGTCAACGCGAAAACGAAACAACCGATGCTGCTGGATCCAAAAACATTCATCGTTGCTCCACTGGGTGGAATCTGGTTGGATTATAAACCGATCGCGGCGTAG
Ortholog: Anopheles gambiae | AGAP003343-PA | ortholog one-one
Aedes aegypti | AAEL003890-PA | ortholog one-many
Aedes aegypti | AAEL006989-PA | ortholog one-many
Aedes aegypti | AAEL006992-PA | ortholog one-many
Aedes aegypti | AAEL015654-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002536-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002537-PA | ortholog one-many
Culex quinquefasciatus | CPIJ009085-PA | ortholog one-many
Culex quinquefasciatus | CPIJ017014-PA | ortholog one-many
Culex quinquefasciatus | CPIJ019673-PA | ortholog one-many
Culex quinquefasciatus | CPIJ019751-PA | ortholog one-many
Drosophila melanogaster | FBpp0073409 | ortholog many-many
Drosophila melanogaster | FBpp0078697 | ortholog many-many
Drosophila melanogaster | FBpp0078698 | ortholog many-many
Drosophila melanogaster | FBpp0080164 | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
GO:0004497:monooxygenase activity
KEGG: Orthology:K15005
Pathway name:
Pathway map:NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 2.15757775 0.0002687932 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 0.45837528 0.5282180302 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400