ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB35730.1'
Gene ID: ZHAS_00002630
Protein ID: KFB35730.1
Description: cytochrome P450, CYP 307B1
Location: KE524620.1:250602:252386:reverse strand[JBrowse]
Sequence: >ZHAS_00002630  (1632 bp)    All exons in this region
ATGGATCACATCAGCGTTACGTTGTTGAGCACAAGCAGCACCGCCTACTTGATGGTGAGCTGCCTGTTGCTAACGCTGCTGATGCTGTTGCCCGAGGTGAAGCAGAAAGTGATCGTACGTAGTGATGTGTTAAATGCGCTGAAGCAGCTGCTCACCGGTGTGGGGCTCATGTTTGGGGTGGAAAGTGAACCGGTGATTGCTCCGACCGCTCCCGAACAGCTTCCTCCGAAGGCCCCGGGACCCAAAAGCTACCCGATAATTGGAGCCCTCAAAGAGCTGAACGGGTACGAGGTACCGTATCAGGCGTTCAGTGAGCTGGGCAAGCGTTACGGAGCCGTTACGGCGCTCCGGCTCGGCTCGGTCAACGCGGTGGTTGTGAACGGCATCGAGACCATCAAGGAGGTACTTATCAACCGGGCTCAGCACTTCGACAGCCGACCCAACTTCCGTCGCTATCAGCTGCTGTTTTCGGGCAACAAGGAAAACTGTAAGTATAGCTTGTTACTACTTCCGCTACGACTGTCTGACGAGAGATCGATGTGCAAGTTGTTAACGTTTATGTTTCGTTCACTTGCAGCACTGGCGTTCTGTGATTGGTCCGAGGTGCAGAAGGCTCGCCGTGACATGCTGGTGCCGCACACATTCCCGCGCAACTTCAGCGGTCGCTTTCACGAGCTGAACACGATCGTGGTGGACGAGATCGGCCAGATGCTGGGTGAGATCGGCCGCGGAGAGTCACAGCAGACGCCAACCATTGTCGAGATCAAACCACTTGTGCTCAGTATCTGCGCCAACGCGTTCGCCCAGTACTTCGGTAGCCACCGGTTCGAGGTGCAGGACAAACGGTTCCAAAGGATGGTGAACAACTTCGACCAGATCTTCTACGAAGTCAACCAGGGCTACGCTGCCGACTTTCTCCCGTTCCTGCTGCCGCTGCACCGCCAGAACCTGAAGCGCATGGATCGGCTGGCGGAAGAGATTCGCGAGATCATTCTCGAGACCATCATCGGCGATCGGTATGAGCGGTGGGTCGAGGGAAGCGAACCGTGCGACTACGTCGACAGCCTGATCGATCACGTCAAGGGTCGGATGGGTCCGGAGCTCGAGTGGGAGACGGCCCTGTTCGCGCTGGAGGACATCATCGGCGGACATTCGGCGGTTGGCAACTTCCTGGTAAAAACGTTCGGCTACATCGTGCAGCACCCGGAGGTGCAGGCCCGCATTCAGTCGGAAGCTGACGCAATCCTCGAGCGCCACGGCCGGCAGGTGATCGAGCTAACGGATCGCAACGAGATGCCGTACACCGAGGCCGTCATCATGGAGGCGCTGCGGCTGATCGCGTCCCCCATCGTGCCGCACGTCGCCAACCAGGACAGCCAGATTGGAGGTAAATATTTCTTTTCGTTTTATAAGGCGTATTGCACTTCTAAAACCAAAATAAATATTTAAGGTTTCGCCGTGGCCAAGGAGACGCTCATCTTCCTTAACAACTACGACCTCAGCATGTCGCCGGAACTGTGGGACGCACCGGAGCGCTTCGCACCTGAGCGATTCCTGCAGGGTGGACGAGTGGTGAAACCGGACTTCTTCATCCCTTTCGGAGCCGGGCGACGCTCGTGTATGGGATACCGGATGACGCAACTTTTGAGCTTCTCCATCATCTCCAATCTGCTGCACTCCTACACGATCGCCCCGATCGAAGGGCACGACTATCGCGTGCCAGTTGGGTCGCTAGCAATGCCGGAAAAGTCCTACACCTTCAAGGTAACCGCTAGGGAGTGCTAG
Ortholog: Anopheles gambiae | AGAP008682-PA | ortholog one-one
Aedes aegypti | AAEL006875-PA | ortholog one-many
Aedes aegypti | AAEL014208-PA | ortholog one-many
Culex quinquefasciatus | CPIJ000989-PA | ortholog one-one
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: Orthology:K14939
Pathway name:Insect hormone biosynthesis
Pathway map:ko00981