ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB36869.1'
Gene ID: ZHAS_00004046
Protein ID: KFB36869.1
Description: cytochrome P450, CYP 6N1
Location: KE524804.1:6248:7818:reverse strand[JBrowse]
Sequence: >ZHAS_00004046  (1503 bp)    All exons in this region
ATGTGGATTCATTTGGTTGTGCTTGCCGCACTCGCTGCGGTTTACTGGATCCGGCAGCGACTCTCCTATTGGAAGCATCGTGGCGTCGCGTTCGTCGAGCCTTCGTTTCCTCAGGGTAACCTGGAGGGGCTGGGCAAATCGCGTCATATGTCCCAGATACTGCAGGGCTGCTACGAACAGCTGAAGAACCGTGGACCGTTCGGTGGTGTGTTCTTCTTCATCAACCCGGCCGCTTTGATTACCGATCTGGATCTAGTCAAGACGGTACTGGTGAAAGACTTTGCCTCCTTCCACGACCGAAACCTGTACCACAATGCTCGTGATGATCCCCTGTCACAGCATCTGGTCGCAATGGAGGGTTCCAAGTGGAAGAATCTCCGGGCCAAACTAACGCCCACGTTCACCTCGGGTAAGATGAAGATGATGTTCTCCACCGTGACGTCGGTAGCCGAGGAGTTCACCAAGTGCCTCACGGGAGAGATCGCCAGCAACAGTGTTGTGGAGATGAAGGACCTACTAGCACGGTTCACCACCGACGTCATCGGTACGGTGGCATTTGGGCTCGAGTGTAATAGTCTCAAAGATACCAATGCGCGCTTTCGTGTGATGGGCCGTAAGGTGTTCGAACCGTCGCGCTACCGAGCGATGAAAACCTTCCTGGCGGCTCAGTTCCCGCAGTTAGCGAGGACACTCCGCGTCACTCTCACACCGGCCGACATATCGGACTTCTTCATGGGAGTGGTGAAGGACACGATCCAGTTTCGGGAGACCAACGATGTGCAGCGGAACGACTTCATGACGCTGCTAATGAAGGTGATGAAAGAGGACGTGCTCAGTAGCGGCAAAGGAAGTGGCTCGGGTGATCAGCTCACGATGGATGACATCGCGGCCCAGGCGTTTGTGTTTTTCCTCGCCGGGTTCGAGACGTCCTCCACCACCATGTCGTTCTGCTTGTACGAGCTGGCCCTCCACCAGGAGCTTCAGGATAAGGCTCGGGCAAACATTGAAGAGGTTCTCCAAAAGTACGACTCCATAAGCTACGAAGCAGTGCACGAAATGAAGTACATCGAGATGTGCATAAACGGTACAGTTTATTACAAAACTTTGGCCATGTCCATTATCCTAATTCCCTCACTCCCTTTCGTTTTGCAGAATCACTCAGGAAGTATCCGCCAGCGACGACGTTGACGCGGAAAGCTAATCATGATTATCGCGTTGCCGGAACCGACCAAGTGCTGCAGAAGGGGTTGATGGTGGCCGTACCCGTCTACGCCATCCATCACGACCCGGCCCACTTCCCCAACCCGGACCGGTTCGATCCGGAGCGGTTTTCGCCCGAGCAGACCGCCAAACGGCACCCGTTCGCCTATCTGCCGTTCGGCGAGGGTCCACGAATTTGCATCGGACTTCGGTTCGGGATGATGCAGGCACGCATTGGACTGGTTTACCTGCTGAAGCACTTCCGGTTCACGCTGGACGAACAGCGGATGAGCGTACCGCTGAAGCTGTCGCCCTCTAGTCCCGTGCTAACGATCGAAGGAGGGCTCTGGTTGAAGGTTCAGAAACTATAA
Ortholog: Anopheles gambiae | AGAP008210-PA | ortholog one-one
Aedes aegypti | AAEL009121-PA | ortholog many-many
Aedes aegypti | AAEL009124-PA | ortholog many-many
Aedes aegypti | AAEL009126-PA | ortholog many-many
Aedes aegypti | AAEL009138-PA | ortholog many-many
Aedes aegypti | AAEL017556-PA | ortholog many-many
Culex quinquefasciatus | CPIJ005899-PA | ortholog many-many
Culex quinquefasciatus | CPIJ005900-PA | ortholog many-many
Culex quinquefasciatus | CPIJ011129-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016852-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016853-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016854-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016855-PA | ortholog many-many
Culex quinquefasciatus | CPIJ017462-PA | ortholog many-many
Culex quinquefasciatus | CPIJ019704-PA | ortholog many-many
Culex quinquefasciatus | CPIJ019705-PA | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: Orthology:K15002
Pathway name:
Pathway map:NA