ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB37924.1'
Gene ID: ZHAS_00005247
Protein ID: KFB37924.1
Description: AGAP000047-PA-like protein
Location: KE524855.1:767672:769104:forward strand[JBrowse]
Sequence: >ZHAS_00005247  (1176 bp)    All exons in this region
ATGAAAGCCTTCGTAAGTACCGGGTGCTACTTCCGCTGGCCAGAACTTGCCTGGTCCTTCCCCGCTCCTTCGGTGTGTTTGACTCGACTCGTAGGGCCCACCAACTTCCTTAGTTTCCTCCCTCAAATACCCCATCCTTTGAAGCTTCCTTTCTACATCCGACAATTCCTGGTCCAATCCTTTTGCCATCCTAGTACTTCGAGTACTAAGGGGTTCTTTAAAGTAAATCAGCTGTTGTGCCAAATGAGTGCCCAAAAGTAGCAAAGTGATACTGAATGCCGCATCGATCAACCAATGTCTGGGACATCCAATCCTATCAAACTATCTAGTCGACAGAGTCCAACTCCCGGGAGCGGGCGGAATTCTGGAAGCTATCGGACTATGTGGTCACTCATGTTTTTGTTCTCCCTCATTCTCTGGCTCTCGTTTGTCCGGCGCAGGTACTTGGATCTGCAGTGTTGCTGCTGGCTTCGGCCTCCGCTTCCGGCTCGTACCTCGGAGTTGCGCTGTCGTCGCAGTACCAGGCGCACGATGGTATCGGTGGCTACTCGTACGGCTACGCTGAGCCCAACTCGCAGAAGCACGAGTCGAAGGATGCGCACGGTGTGACCCACGGCGGATACTCGTACGTCGACGCGAACGGACACGTGCAGAGCGTGAAGTACACGGCTGACCCGATCAACGGATTCCGCGTCGCCGGCACCAACCTGCCGCAGGGTCCCGCCCCGGTCCACGCCGCCGCCCCGGCCCCGGCCTGGAACGCGTACGCCTACGCCCCGGTCGTCCTCGGCCACAACGGAGCCCCGATCGACACGCCGGAAGTGCAGCACGCCAAGGCCGCCCACTTCGCCGCTCACGCCGCCGCCAAGGCGCGCCTCCACAAGCGCTCCCTGTACGCCTCGTACCCCTGGAGCTACGGTGCGGCCGCCCCGGTCGTCCTCGGCCACAACGGCGTCCCGCTCGACACGCCCGAGGTCGCCCACGCCAAGGCTGAGCACGCCGCCGCCCACGCGAAGGCCCTCGGCTACGCGCATCCCGCTGGTCCCATCCCCGACACCCCCGAGGTCGCCCACGCCAAGGCCGAGCATGCCGCCGCCCATGCCGCCGCCCGCGCCAACCAGCACGCCCTCGCCCCGGCCGTGAGCCACTCCTCGCACGCCATCCACGCCACGCACGTCGCCCATCACCACGCCCCGGCCGCCCACTACCCGCAGCACGTCCCGGTCATCAAGAACGGCGTCCCGGTCGAGACGCCCGAGGTGCAGCACGCCAAGGCCGCGCACTTCGCCGCCGTCGCCAAGGCCGGCGGATACGCGCCCGCCCACGCCCACTCCTACTACCCACAGCACATCCCGGTCATCCACAACGGAGTCCCGGTCGAGACGACCGGAAGTGCAGCACGCCAAGGCCGCTCACTTCGCCGCCCTCGCTGA
Ortholog: Anopheles gambiae | AGAP000047-PA | ortholog one-one
Aedes aegypti | AAEL001290-PA | ortholog one-many
Aedes aegypti | AAEL007922-PA | ortholog one-many
Aedes aegypti | AAEL013789-PA | ortholog one-many
Aedes aegypti | AAEL015119-PA | ortholog one-many
Culex quinquefasciatus | CPIJ017876-PA | ortholog one-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA