ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB38104.1'
Gene ID: ZHAS_00005379
Protein ID: KFB38104.1
Description: AGAP000988-PA-like protein
Location: KE524867.1:634536:635327:forward strand[JBrowse]
Sequence: >ZHAS_00005379  (654 bp)    All exons in this region
ATGTCCCTGTCTTGTCGATATCTAGATGCCCAGAGTGCGTTCAAGTGTCCGAAGAGCCGCGGTCAGTTCGAGGATCCGGTCCAGTGTGATAAGTACTACGTGTGTGAGGACGACGTAGCCACCGAGAAGCTCTGCCCGGACGGGCTGGTGTTCGACCCTACGATCAAGCTCATCAACAAGTGCGACCAGCCGTTCAACGTCGACTGCGGCGATCGATTCGAGCTACGTAAGTTCCCCCAGCCCCTTTGTGCACGGGTGCACTGCCGCTGACAACCTTCGTTTTCCATCCTGCAGAGCCGCCACAGGGTACAACCGACTACTGCCCACGCAAGAACGGGTTCTTCAGCCACCCGGATCCGTCGATCTGCAATGTATTCTACAGCTGCATCAACGGCGAGGAGCTCGAGATGGGCTGCAGCGGCGGTCTGCACTTTGACGAGAAGTCGGGCACCTGCGTCTGGCCGGATGTGGCGGCCCGCGAAGGCTGTGGTAGCAACGCCAACAGTACGTAATGTTTGGGCGCGTAGCGCATGAGTAAAATCGTCACTCACTTCCAACGTGCTTTGCTTTGCAGAAAAACTCAACGATGGTTTCCAGTGCCCGAAGGAGACGCGCTATGATAAGAACGGCCAGGTGATCACGCATCCCAACTACCCGCATCCGACCGACTGCTCCCGATTCTACTACTGCCTAAACGGGGTTGAGCCTCGTCTCGGCCAGTGCGATGCCAAGATGGTCTACAACGAGGACCTGCAGCGTTGCGATGACCCGGAGAACGTGCCGGAATGGTAA
Ortholog: Anopheles gambiae | AGAP000988-PA | ortholog one-one
Aedes aegypti | AAEL009577-PA | ortholog one-one
Culex quinquefasciatus | CPIJ000680-PA | ortholog one-one
GO: GO:0005576:extracellular region
GO:0006030:chitin metabolic process
GO:0008061:chitin binding
KEGG: NA