ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB38318.1'
Gene ID: ZHAS_00005670
Protein ID: KFB38318.1
Description: Carboxyl/Cholin esterases,J C-term fragment
Location: KE524938.1:32003:33395:reverse strand[JBrowse]
Sequence: >ZHAS_00005670  (1086 bp)    All exons in this region
ATGGAGGTATCGTAAGTGAAAAAGATGCCTCAGACATCCATCACTTAAATAAGAATGGAACTTTTATCTTGTACTTTAAAAGGGCTTTAAGTTGGTTATTTTTGTTTTCTTTTCTTGTGCGTCACATTGCGTCTATTCAAGTTTTCGGTTTAATATGGAATGAAATGAAACCTCTACTTATGCTTCCACATTCTCTTGCAGAGCCATCCGGTTGGCGGAAGCGGTCGGATGCCCGCACGACACGAGCAAGCTCAGCGAAGCGGTCGAGTGTCTGCGCGGCAAGGACCCGCACGTGCTGGTCAACAACGAGTGGGGTACGCTCGGCATCTGCGAGTTCCCGTTCGTGCCGGTGGTGGACGGTGCGTTCCTGGACGAGACGCCGCAGCGGTCGCTCGCGAGCGGGCGCTTCAAGAAGACGGACATCCTCACCGGCAGCAACACGGAGGAGGGCTACTACTTCATCATCTACTACCTGACCGAGCTGCTGCGCAAGGAGGAGGGCGTGACGGTGTCGCGCGAGGAGTTCCTCCAGGCGGTCCGCGAGCTCAACCCGTACGTCAACGGGGCCGCCCGGCAGGCGATCGTGTTCGAGTACACCGACTGGACCGAGCCGGACAACCCGAACAGCAACCGGGACGCGCTGGACAAGATGGTCGGCGACTACCACTTCACGTGCAACGTGAACGAGTTCGCCCAGCGGTACGCCGAGGAGGGCAACAACGTCTACATGTACCTGTACACGCACCGGAGCAAGGGCAACCCGTGGCCGCGCTGGACCGGCGTCATGCACGGCGACGAGATCAACTACGTGTTCGGGGAACCGCTCAATCCCACCCTCGGCTACACCGACGACGAGAAGGACTTCAGCCGGAAGATCATGCGATACTGGTCCAACTTTGCCAAGACTGGGTACGTACCGAAGGAGAAGGAGATCTGTGGGGAGTCGAGGTCTGACGATGTTTTCCAAACCCCAAACAGCAATCCAAATCCCAGCCAACTCAGCACCGACTATCCCGAATGGCCCAAGCATACGGCCCACGGACGGCACTATCTGGAGCTCGGCCTCAACACGTCCTTCGTCGGGCGGGGCCCACGGTTGAGGCAGTGTGCCTTCTGGAAGAAGTATCTACCCCAGCTAGTTGCAGCTACCTGTAAGTTGTGACCGTTTTGTCATTTCAGCTCATTTAACGCTGGGGAGCGTTGGCTTTCGGGAACTCGCCCCTCTTTGCTTTTTACTAACCAAAAACCCATCCCTCCATTTTCCGCAGCTAACCTACAAGTGGCACCACCACCAAGTGCACCGTGCGAAAGTAGCGCCTTTTTCTACCGGCCTGATCTGATCGTACTGATAGTGTCGCTGCTTTCCGCCGCCGCATTCACCTACACACAATAA
Ortholog: Anopheles gambiae | AGAP001356-PA | ortholog one-one
Aedes aegypti | AAEL000511-PA | ortholog one-one
Culex quinquefasciatus | CPIJ006034-PA | ortholog one-one
GO: GO:0004104:cholinesterase activity
KEGG: Orthology:K01049
Pathway name:Cholinergic synapse
Pathway map:ko04725