ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB38766.1'
Gene ID: ZHAS_00006168
Protein ID: KFB38766.1
Description: AGAP001722-PA-like protein
Location: KE524972.1:284016:285777:forward strand[JBrowse]
Sequence: >ZHAS_00006168  (1689 bp)    All exons in this region
ATGCTCAAGTTTGCGGTAATCTTGTCGTTGTTGGCCATCGCTGCGCACGCGCAGGATGCGGTAGGTTACTCACTCCGTAGGGAAGCTCTTCGATGAAATTCACATTTACATTTGCTTGTCTTGTTCCTTTTAGTCCCGTCCTATCATCAACACCAGTGGTGGCCAGATCCAAGGTGTAACGTCCAGTTGCGGCCTGTTCTGTAGCTATTTCGCGTTCAACGGAATCCCGTACGCGCAGCCTCCGGTCGGTGATTTGCGCTTCCGCAACCCCCGTCCGCACCAGGGCTGGCAGGGGGTGAAGGATGGTAGCGAGCACAGGGAAACCTGCCCGTCGGGTGGCTTCCTGGGTGGCGTATCGGGCAGCGAGGACTGTCTCTACCTGAATGTGTACACGCAGAACCTGATCGGATCGCGCCCGGTTATGGTTTGGATTCACGGTGGCTCGTTCACTGGCGGTTCCGGCAACTCGTGGATCTACGGCCCGGACAATCTAGTACCGGAAGACGTGGTGGTCGTTACGATCAACTACCGTCTGGGCATTCTTGGATTCTTCAGCACGGACGATGTGCACGCGGCCGGAAACTGGGGCATGAAGGATTGCGTGATGGCACTGCAGTGGGTGCGTCAGAACATTGCGGCCTTCGGTGGCGATCCGAACAACGTGACCATCTTCGGTGAGAGTGCCGGAGGAGTGGCCGTCCATTTTCTCGTCCTGTCCCAGAAGGCGTCCGGTCTGTTCCACAAGGCGATCGCCCAGTCCGGTACGGCCTTGTTGCCATGGGCCTTCCAGTACCGGCCGCGAGAACTGGCCTACCAGCTGGCCGATAAGTTCGGTTACTCGCACGATAGCGCACAGTTGGTGCAGAGTCTACGCAACACACCCATCGAGTCGCTGATCAACGCCCAGAACGGCTGGTTGGACATTCCGATCCCGCGTGGCTTCAAACCGTTCGACTTTGTCCCGAATGCGGAACCGGTGAACTCGCCGGAAGAAACCTTCCTCACGCAGCTTCCGATCGACATCCTGAACGCGGGCACGTTCAACCACGTCCCATTCATTGCCGGATACATGAGCATGGAGAGTCTGTTCATGGTGTACGAGCACACGATCGATAGCACCGTGTGGCAAGCGTTCACCCAGAACCCGGACTACTTCGTGCCGCACTTCTGGAACATTCAGCACGGTACGGCCGCATCGGCTGCCGTCAGCCAGGGCTTCCGCAATGCGTACTGGCAGGATCGGCCACTGAACGACAACATCATGGTCGAGTGGCTCACCTTCCACACCGACCAGCAGTTCATCTACGGCATTGACAAGACCGTCCGTCTGCACGCCCAGCGATCCACCGCCCCGACCTACTACTACCAGTTCAGCTTTGACGGTGACCTCAACCTGGTGAAGCGCCTGCTGTTGCTGGGCAGCTGGCCCGGTGCAATGCACGCCGATGACATCCCGTACCTGTGGTCGGTGACGGACCTTACCATCTCGCCAATCCTGCCGACGAATCATGCCCGTACCGTCAGCAACCGGTTCGTCCGTTTGTTCACCAACTTTGCCCGCTTCGGCAATCCTACCCCGAACGCGGTCGACACACTGTTGCAGAGCCGCCAGTGGCTGCCAGTCACCGCTGCGACCGTGAACTACATGGACATTGGGCACGATCTGACGACCAGCGTCAACCCGAACGGACAGCGTACGTCCGTTTGGCGTGACCTGGAGTCGCGCTATGCCAACGATCCGTTCCGTTTCCCACGCAACTGA
Ortholog: Anopheles gambiae | AGAP001722-PA | ortholog one-one
Aedes aegypti | AAEL003181-PA | ortholog one-many
Aedes aegypti | AAEL003187-PA | ortholog one-many
Aedes aegypti | AAEL003195-PA | ortholog one-many
Aedes aegypti | AAEL003196-PA | ortholog one-many
Aedes aegypti | AAEL003201-PA | ortholog one-many
Culex quinquefasciatus | CPIJ018232-PA | ortholog one-many
Culex quinquefasciatus | CPIJ018233-PA | ortholog one-many
GO: NA
KEGG: NA