ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB38767.1'
Gene ID: ZHAS_00006169
Protein ID: KFB38767.1
Description: putative esterase
Location: KE524972.1:286470:288242:forward strand[JBrowse]
Sequence: >ZHAS_00006169  (1701 bp)    All exons in this region
ATGTTGCGTACTGTAGGGAAGATTCTTGTTTTCGTGCTGATAGCCGTTTGTTACGTTTCCTCGCAGGATCCCGCGAGACCGATCATCACCAGCCCTGCGGGCCAAGTGCAAGGAACAACCGAATCGTGTGGCCTGTTTTGTAGTTACTATTCGTTCAAAGGAATCCCGTACGCAGAACCACCCGTAGGGGCGAGACGCTTCCGGAATCCCGTCCCTCATGGTGGGTGGACAGGGGTACGTGATGGGTCTAGCCATGGGTCGGATTGTCTGCAGGCGAGTCTGATCCCGGGAGAGGTGCGTGGTAGCGAAGATTGCCTGTTTCTAAACATCTACACCCAGCAGCTCGTCGGCCAACGGCCCGTGATGCTGTGGATCCACGGAGGTGGATACGGTGCCAATTCGGGCAACAGCGACGAGTTCGGTCCGGAAAAGTTGGTCCAGGAAAACGTGCTGCTGGTAACGATCAACTACCGACTGGGAGCGTTGGGATTCCTCAGCACCGGCGATCGGTATGCTCAGGGAAACTGGGGACTGAAGGATTGTTTGCAGGCGCTCCGTTGGGTCCGAGCGAACATAGCCGCGTTCGGTGGTGATCCAAGCAATGTGACGCTGTTTGGTAATTCTGCCGGGGCTGCGTTGGTCCATTTGTTGGTGCTTGCTGACGCACCGGCCAATGAAGGCCTGTTCCATAGAGCGATCGCCCAGAGCAGCACCACGCTGGTTCCGTACGCCTTTCAACCACGGCCACGATTCTACGCGGACCGTATCGCCTCGGCGCTCGGTTTTGGCACAGACAGTAGCGTGTACGTGGAGCAGTTGAGGTCCATTCCGGTAGCACAGTTTATTCCCTTCCAGGAGGCGGCATTCACAATTCCCGTACCACGGTTTCTGCGTCCGATTGACTTTGGACCAGTCGTTGAACCTCTCGACGCACCCGAAGAGACCATCGTTCGACAGCGTCCGATTGAGTTGATCCGCGAACGTGGCCATCGGGTACCCTTTATGGTCGGGTACACCGATCTCGAGGGTGCGTTTTTTACGGCCCTCGAAAACGCAATAGATCCAACCGTCAAGCCACAATTCAACGCCAATGCGCACCTCTTGGTTCCTTTCTTCTGGAATGTTTCACCGGGCAGTGCGGCATCGACGCAGATTAGTAATGCATTCCGGAACCACTACTGGCAGGGTCGACCGATCGATGCGAGTGTGGACTACGAGTGGACGGTGTACCAAACCGATCATCAGTTTCTGTTCGCCATCGATCAGACGGTGCGCTTGCATGCACAGGCCGCTCCGTCAGTGCCACTGTACTACTACCAGTTCGAGTACGATGGGGATTTGAATCTGTACAAGAAAATCTTCGGTGTCACGCACCCGGGCGCAATACACACGGATGAGTTACCGTATCAGTTCCACATACCGGCAGCCATGCTGGAACCGATCCCACCGACTAGTCATGCGAACACCGTGAGCAGCCGGGTCGTGCGGATGTGGGCCAACTTTGCTCGGACCGGGTAAGTAGCTACAGTAGGGGTCCTCTAGGTGTTGACCTCGATGACTTAATGTTCCACGAATTTTTCTTCCAGCAATCCAACACCATCGCAGGAAGCATTATTGCAAAACATTCAGTGGCCTATGGTGCGGTCCGACGGAGCCGGTTATCTTGCCATCGGGCACGACTTAGTACCATGGCAGCAATCACCAAATCCTACCAGAATGTCCCTTTGGTACAACCTCCAGCAAACTTACGCCAATGCGCCGTTCGAAATTTAA
Ortholog: Anopheles gambiae | AGAP001723-PA | ortholog one-one
Aedes aegypti | AAEL003198-PA | ortholog one-one
Culex quinquefasciatus | CPIJ018231-PA | ortholog one-one
GO: NA
KEGG: NA