ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB38798.1'
Gene ID: ZHAS_00006268
Protein ID: KFB38798.1
Description: AGAP000437-PA-like protein
Location: KE524974.1:128415:129986:forward strand[JBrowse]
Sequence: >ZHAS_00006268  (1539 bp)    All exons in this region
ATGCGTGCTTTTGTGGTGAGTGCGCCCTGGAATTCGACTCAGCAACCGCGACCGCACAATCGCATCTGGAACCGCCAAACGCGATCAACGATCAACTCCCCAAAGGGCACTCAGCAATCAATCCTAGCTCCCCGGGACTCCAGTGAGGCGTATCTGGCGTGCGTTGTGCGTCGCTGGTGGCGAAGAGCAGTGTTTCAGTGTTCGGGGGAGGTGTTCGATGAATCCTTGCTAATCTGTCCGGTCTGTCTCTGTTGTCTTTCCGTTCCGATCTAGATCTTCGCCGCCTGTTTGGCAGTGGCGTCGGCCGACATCGGATTGAAGCTGCGCCAGGCCGCGGCCCTCGGTGCCGCTAGCAGCTACGACGTCGGACAGCAGTCCGTGTCGGTGGACTACGCACCGGTCGTGTACGAGGACACCATCACCGAGGGTGGCCGCTCGTTCGGAGGTGCCGCCGCCGGTGCTAACTCGTTCGCCGGTGCCGGAGCTGGCTCGGGAGCCGGATTCGGTGGTGCCGGAGCTGGTGCCGTTGCTGGCGCTAGCGCTGGAGCTAGCAGCAGCAGCGGGGACTACGCTGCCGGCTACCAGGCTGGCCTCCGCGCAGGAGCCGCCGCTTCTGCCGGTGCTTCGGCCACGGCTGGTGCGTCCAGTGGTGCGGCAACTCGCTTCGGAGGCTCCGGTTCGTTCTCCGGCTCGGCCGCCAACAGCTTCGCATCCGGCTCCAGCTTCGGATCGGGCTCCAGCTTCGGATCGGGCTCCGGCTTCGGTGCGGGCTCCTCCGCCGGTGCTAGTGCGACCGCTTCCGCCAAGGCCCAGACCCGTGTCGTATACGCCGCCCCGGAAATCCGCAAGCACTTCTACTACCACGTCGCCCCCGCAGAGGCTCAGGCTGAGGCTGAGGCCGACACCCTGACCATCACGCCCAAGAAGCACTACAAGATCATCTTCATCAAGGCCCCGACGGTGAGTGCCAACGCCGGAGCTGCATCGCGTGCCGCCAGCAAGACCGAGGAGAAGACCATCGTCTACGTGCTCGTCAACAAGCCATCGCAGGCCAAGGCCGGTGCCGTCGCCGACGCCAGCTCGTTCTCGTCTGGCAAGCCGGAGGTCTACTTCATCAAGTACCAGGGCAAGGACGCTGCCGCTGCCGCCTCTGCTTCTGCCTCCGCTGCCGCCAACGCCGCCTCCGGTGCGTTCTCCGGAGCCGGATCGAACGCCCTCGCCGGAGCCGGAGCCGGAGCGAACGCCCTCGCCGGAGCTGGAGCTAGCGCACTCGCCGGTGGTGAATCGTACGTCAACGATGCCGGTTTCGATGCTGGATTCGGTGGCTTCTCCAACGCCGGTGCGTCTGCTGGTGCCTCCGCCGGTGCCTCGGCCCTCGGTAACGACTTTGTCGACTTCAACGTCCGCCAGGGAGACGTCTCGGCTGCGTCTGCTGGCAGCAGCGGCTACAACGCTGGCTTCACCGCCGGTTACACCGAGGCTGCTGCTGGTGCGAGCGCTTCCGCCGGTGCCGGTGCCAGTTTCGGCGTGACCCCCGCTTACGATAGCGGATCGGACACCGTCGTCTACTAG
Ortholog: Anopheles gambiae | AGAP000437-PA | ortholog many-many
Anopheles gambiae | AGAP013080-PA | ortholog many-many
Anopheles gambiae | AGAP013175-PA | ortholog many-many
Anopheles gambiae | AGAP013308-PA | ortholog many-many
Anopheles gambiae | AGAP013319-PA | ortholog many-many
Anopheles gambiae | AGAP013421-PA | ortholog many-many
Aedes aegypti | AAEL017103-PA | ortholog many-one
Culex quinquefasciatus | CPIJ008508-PA | ortholog many-many
Culex quinquefasciatus | CPIJ017828-PA | ortholog many-many
Culex quinquefasciatus | CPIJ017829-PA | ortholog many-many
GO: NA
KEGG: NA