ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB38925.1'
Gene ID: ZHAS_00006247
Protein ID: KFB38925.1
Description: Carboxyl/Cholin esterases, I
Location: KE524974.1:1432825:1436832:forward strand[JBrowse]
Sequence: >ZHAS_00006247  (1941 bp)    All exons in this region
ATGACTAGCAACCACTCCGTCTGCCGGCGATCGTGCGCCAACGTGCTGGTGCTGCTGCTCGGTGCGACCGTGATATGTCCGGCGTACGGCATCATCGACCGGCTGGTGGTGCAGACCAGCAGTGGACCAATACGCGGCCGCTCGACCATGGTCCAGGGGCGCGAGGTGCATGTCTTCAATGGGGTGCCGTTCGCCAAACCGCCGGTCGACGGGCTGCGGTTCAAGAAGCCGGTCCCCGCCGAGCCGTGGCACGGAGTTCTCGATGCAACCAGATTACCTCCATCGTGCATTCAGGAACGGTGAGTCGGTGCGATTACCTGCTATCCTTTCCGCCACTTGTGTCCGCAGTCGCACCTCCAGACATAGGGCCAAACCTGACTGGAGCTCTGGTGATGAGCAATGTAGACACGGGTATCACCGAACGTAGACACCTGACATACATATCTAATGAAACAATCATCCGCTAACCCTTGCTTACGCTCGCTACAGGTATGAGTATTTCCCCGGCTTCGCTGGCGAAGAGATGTGGAATCCCAATACCAACGTTTCTGAAGATTGTCTGTATCTGAACATCTGGGTGCCAACCAAAACTCGTCTCCGACATGGCAGGGGTCTGAACTTTGGCAGCAACGACGTAGGTTACATCCGACATATGTCTAGAGTTCGCTAATTGACGTTGATGTGGGGGAATCTTTGTTGTACTACTACAGTACTTCCAGGATGACGAGGACTTTCAGCGCCAGCACCAATCGAAGGGTGGTCTGGCGATGCTAGTGTGGATCTACGGGGGTGGCTTCATGAGTGGCACCTCCACGCTGGACATCTACAACGCCGAGATACTGGCGGCCGTCGGTAACGTCATCGTAGCCTCGATGCAGTATCGCGTGGGCGCGTTCGGTTTCCTCTACCTGGCACCGTACATCAACGGCTACGAGGAGGACGCTCCGGGTAGGTGCACCATGCTCGAACGGCTCCCGGCACGGGGTAGTATTTCTCAACCCCGAATCTTTTCACACACGCACAACAGGAAACATGGGTTTGTGGGATCAGGCGCTAGCGATACGGTGGCTGAAGGATAACGCCAAGGCGTTCGGTGGCGACCCGGATCTCATCACGCTGTTCGGTGAGTCGGCTGGCGGTAGCTCGGTCAGTCTGCACCTGATGTCGCCCGTCACCAGAGGACTGTCCCGGCGTGGCATTCTGCAGTCGGGCACGCTGAACGCCCCGTGGAGCCACATGACCGCCGAAAAAGCGCTGCACATTGCCGAGGGCCTAATCGACGACTGCAACTGTAACCTCACGATGCTGAAGGTGGGTAGCTATTTGGCTCCGTTTTAGCTCCGGACATCATGCATCATACCCTTTTTGTTCGGAAACCGTATGCAGGACTCGCCCAGCACGGTCATGCAGTGCATGCGGAATGTCGACGCCAAAACAATCTCCGTGCAGCAGTGGAACTCCTACTCCGGCATACTGGGATTCCCGTCCGCGCCGACCATCGATGGAGTCTTCATGACCGCGGATCCGATGACCATGCTGCGTGAGGCGAACTTGGAAGGAATTGACATCCTGGTCGGTAGCAATCGCGATGAAGGTAGGTTCAACACTCAACAGATTTTTGCTAGTGTCTATAGGTGCATTGCATGACCTAGGAGTCATCCTAAGATACACTTAGTGTCATACTACGACTAAATACTGTCTGCATCCGTACTTTACGACATCCACCCTTTCAGGCACATACTTCCTCCTGTACGACTTTATCGATTACTTTGAGAAGGATGCGGCCACCTCGCTACCCAGGGACAAGTTTTTGGAGATCATGAACACCATCTACAACAAAGCCTCCGAACCGGAACGCGAAGCCATCATATTCCAGGTATGGGGAGTGCTATCACACACAAACACACGCTGTAGGTTAAGGCATTGTCATTGATTCGTTTTTCCCCTTTTGGCTGTCTCGGGTAGTATACGGGTTGGGAGAGTGGAAACGACGGCTACCAGAACCAGCACCAGGTGGGCCGGGCGGTCGGCGACCACTTCTTCATCTGCCCGACCAACGAGTTCGCCCTCGGTCTGACGGAACGCGGCGCGTCGGTCCACTATTACTTCTTCACGCACGTAAGTGATCCACAAGATTTGTTGATGTGAAAATAAAAAATGATAGCAAATTTCTATAGAAAGCATTATAGAGATGAACTTCTTTGGTGTTAAAAACCAGTTTGACAGCGTTTTCATTTATAATGAACACGCTATCGTCATGGGTGAAACCGTATACCAACTACGTTTGATGATTTTTTTCGCCACATTGACTATATCGTTCGTCAACTAAGGAATAGCTACAGCGTTCTGTGATTTGGACCAGAAGGTCGCTTTAACCTTCAAAATATTTATTAAAAACTTATTATGGGTTTTATTATCTCAAGAACGGCTCAAAGCTCTGGAGAAATATGTTTTCCGAAGAGCACGACATCGTGATCCATATTCAACCAATCCTGGCAATAGTGCATTTAGAGGAGATGGCCCCGAATTAAGATTTTCGTAATTAGATAATTAGATATTTCGAATCCTGAAGAGTCTTAGAATACGCTGTTAAGTCCTTCTTAAAACCATCGCTTAAACCCAGTCAATGACTGCTTTAAGGCTGCTTTAAGAGTACTATTGAAATGTAATTTTGCTGTAAGTTAGTTTACGTTTGGTATCTCCAAAGTAGGGAAAAATCAAATGTAGTGGATATTTCACTCGAAAATCCATAATAAACTGCCATAAAATCATGAAAACACAACCTATTGAAGTACAGGAGGAAAAAAAACTGACCAATCACCCATTATTAGATGCAGACTCCTTTTTGGTGAAATCAATTCAAGAGACAAATACATGATGTCCTGCATCTGTAGAAAATGCAACCACGAATGACTAAATACCACAGTCTCAACAAAAGTTCATGATAATACGAAAGTGTACGTACATCAATCCTCAAAAATGAGGATCAACACCAAACAATATATTATCAAGGACTCAACCATCTTACATGTTTTGACATTTCTTTAAGAGTAATTAGTCTACATCAATGCTGCCAAAAGGCTTTCAAGCCTTAACGTGGTTTTTTGTGCGTTGAGTTAAAGCTATTTGTACTTTGCGGGGTATATGAGCAGTAACACAAAGAGATAGAAGATTTAAAGGGGTTTTAACAATGTTTGTTCAATCCCAAAGGATCTGGAAATGTCGGACCGCAAGATGTTTTGGGCTTAAGCCAATGGAATCCATCTTTATAGACATAATTTGGTGTTGTTTCAAGTATGGTTAGGCCATGATTCGGTGCAGATGTTACCAGAATTGGTATGGTTTGTATCAAAGGAATTCTCCTCTCCCCTCTTTAGCGCACCAGTACCTCCCTCTGGGGCGAATGGATGGGCGTTTTGCACGGTGATGAGGTGGAGTACATCTTCGGCCAGCCGATGAACGCGTCGCTGCAGTATCGCCAGCGGGAGCGGGACCTGAGCCGGCGTATGGTCCTGTCAGTGAGCGAGTTCGCACGGACGGGGTACGTCACCATCAACCTATCCGAGGATGCCGCACGAAACACCTATAACCGGCTCTCGACATTCTGTTCTCTTCCATTTGCAGAAACCCGGCACTCGAGGGGGAACACTGGCCGCTCTACACGCGCGAAAATCCGATCTACTTCATCTTCAACGCCGAAGGGGAGGACGATCTGCGCGGCGAGAAGTATGGCCGCGGTCCGATGGCCACCTCGTGCGCCTTCTGGAACGACTTCCTGCCGAGGTTGCGCGCCTGGTCCGGTACGCTGCTGAGACAGGAGTGTTGACTAGCGTCCCGCCAAGGGTACTTATATTTCGTTCTTCACCTTTCCTTGCAGTTCCCTCGAAGACGCCGTGCAACTTGGTCGAGGCCATCTCGCAGGGCAGCAGAACCGGGGCGACGTTGCTGTACCTCGTAGCGATGCTGGTCTTAGTACTGTCCCTGCGCCAACCGGCGCTTGTGAACTAA
Ortholog: Anopheles gambiae | AGAP000466-PA | ortholog one-one
Aedes aegypti | AAEL012141-PA | ortholog one-many
Aedes aegypti | AAEL017250-PA | ortholog one-many
Culex quinquefasciatus | CPIJ000662-PA | ortholog one-one
Drosophila melanogaster | FBpp0082248 | ortholog one-one
GO: GO:0004104:cholinesterase activity
GO:0001507:acetylcholine catabolic process in synaptic cleft
GO:0003990:acetylcholinesterase activity
KEGG: Orthology:K01049
Pathway name:Cholinergic synapse
Pathway map:ko04725