ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB38993.1'
Gene ID: ZHAS_00006693
Protein ID: KFB38993.1
Description: cytochrome P450, CYP 9M1
Location: KE524975.1:346360:347952:forward strand[JBrowse]
Sequence: >ZHAS_00006693  (1593 bp)    All exons in this region
ATGTTGCTACTGTGGGCGTTGCCGTTGGCGTTGTATCTGTTGTACCGCTGGAGCATCGCCACGTACGATTACTTCGAGAAGCGGAACATTCCGTACGTGAAGCCGGTGCCGTTCTTCGGTCAGGTGTGGTCCTTTTTCACGCAGGAGAAGCATGCCGTCGACGTCGCCTCCGAGGGTTACTACATGTTCCCGAACACGCGCATCTCCGGCGTGTTTATACTGCGCACCCCGGCCTATCTGGTGCACGATCCGGTACTCTACAAGCAGATGGCCATCACCGACTTTGACCATTTCACGGACCACGTATCGGAACTCTCGGTCGAGCAGGATCCCCTGTTGGCGCGCTCGTTGTTCTTCACACGTGGAGCACGTTGGCGACACCACCGCACGGGACTGAGTCCAGCCTTCACTGGGAGCAAGATGCGGAACATGTTCAGCCTACTTTCGAAGAGTGCCAGTGATGCCATGGAACGGTTGGTGTTATTCTCCCGATCGGAACCGATCTCTATGGAGCTAAGAGATCTCTACTCAAGGCTGGGGAACGATGCAATGTCCTCCATCTCGTTCGGTGTCGAGGTGGACTCCCTAACCGATCGTGACAACGAGTTTTTTATCAAAGGCAATCGACTGGCCAAGGTGGATGGGTTGCCAGGACTAAAAATATTGATGTCCGCCATCGTACCGGGACTGTTTAAGTTCCTCCGGATAGGCATACTCTACCAGGATGTCAACGACTTCTACACGGAGGCGGTGTCAACAAATATTCGCTACCGAGAGAAAAATGCCCTCAAGCGTCCCGATTTCATTCATCTTCTATTGCAGGTGCGTAAAAACGAGCTGAACTGTGAACAGACCGACGACGAAGGCCTCGATAGTGCCGGTTTTTCTACACCAGAAACGCACACTCTACACAAGAGCGACGATCCAGGTGAAAAACTTGAATGGCGCGACATCGACATTACGGCGGCCGCTGCATCGTTCTTTTTTGGCGGAATAGAAACCACAACCACTCTGCTGTGTTTCGCGAGCTACGAGCTGGCGGTTAACCCTTCCATTCAGGCCCGGTTACGAGCTGAGATAGATCTCGCTCGTGAAGAACTAGAGGATGGGATTACTCCAACCTACGAGGTCCTGCAGAAGATGAAATACATGGATATGGTTGTCTCGGAGACTCTGCGTCGTTGGACTCCTTTCGGAACGACAAATCGCCGATGCACCAAAGATTACACATTCACCAACTACGACGGAACGCAGATCACCATCGAAAAGGGGTTAAACATCTCGATTCCACTGAAAGCGTTCCATCTGGACGAGAAATACTTCCCCGATCCGCTGCGCTTCGACCCGGAACGGTTTTCAGATCTGACCCAAATCAACCAGGACGCGTACGTCCCCTTCGGCACGGGCCACCGGAACTGTATCGGCTCGCGGTTGGCGCTGATGCAAGCGAAATGTTTCCTTTTCTACATGCTTTCCAACTTTGCTATCGAGCCCGGACCTAAACTGACCATTCCAATCGTGCTGGATGAAACGTCCGCCGGTCTGAACGCGAAGCATGGTTTCTGGATGACTCTGATCCCGCGAAATATTTAG
Ortholog: Anopheles gambiae | AGAP009363-PA | ortholog one-many
Anopheles gambiae | AGAP009374-PA | ortholog one-many
Aedes aegypti | AAEL001288-PA | ortholog many-many
Aedes aegypti | AAEL001292-PA | ortholog many-many
Aedes aegypti | AAEL001312-PA | ortholog many-many
Aedes aegypti | AAEL001320-PA | ortholog many-many
Aedes aegypti | AAEL001807-PA | ortholog many-many
Aedes aegypti | AAEL009591-PA | ortholog many-many
Culex quinquefasciatus | CPIJ014218-PA | ortholog many-many
Culex quinquefasciatus | CPIJ014219-PA | ortholog many-many
Culex quinquefasciatus | CPIJ014220-PA | ortholog many-many
Culex quinquefasciatus | CPIJ014221-PA | ortholog many-many
Culex quinquefasciatus | CPIJ014336-PA | ortholog many-many
Culex quinquefasciatus | CPIJ019765-PA | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Down -0.55031931 0.4234556094 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 0.52268332 0.7406843709 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400