ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB39026.1'
Gene ID: ZHAS_00006736
Protein ID: KFB39026.1
Description: Glutathione S-transferases, Unclassified
Location: KE524975.1:526289:528109:reverse strand[JBrowse]
Sequence: >ZHAS_00006736  (657 bp)    All exons in this region
ATGGCCCCATTGGTACTGTATCACTTTCCGGGTTCACCACCTTCGCGCTCGGCTTTGCTAGTTATCCGCAATCTGGAGCTGGACGTTGAGGTAAGGCGAAACAAAAATGTTAAGAATTGTTACAGCAACAACATCGTGATGTAGTGCTTCTCATATACTTGAAGTTAGATTTTAAACCGTTCCGGTTGAAACCGAAAAGTGTATATAAATAGTAATCTTTCAAAAAAATCCCCCATGAAAAATTGAGAAATAAAAAAATAGGAATACGGTTTGTTTCTATAGGCCAACGCGTTCTAAAATCTATTTCGGCGATCTGTTAGTAGTTAAACTGCGTCAATTGTAGATAAATTTGAAGACCGTACGTTAAGAAATTGCCTTTAAGAGTTTGGTGTTTTTATAACAACACATGTTGCTTCAGATTTTTTTAAATGTACTAGTAGGAAATATCTTCGAGTATGATTGTCCAGTTAAAATTTGAAATTAAACCAATCCTAGCTTTAAGAAAGTATTCTACATTAAAATTAGGGACATTCTAAAAACTGTAAATCTAATCTATTCTATGAAACCGATCCTCTGTTACTTTGTAAAAACCGTTTCATTTTCATTTGACCTTATGCAAACGATTGTGAAGGGTCTCATGGACTGGAGATACAGGTGGTTAATTAGCATAAAAGTTCTCACACACTAATTGATACTAGAATCTCCTACGGTATCAGAATTGTTCGTCATACACTTCATGGTCTAATAATAGCTTTAAGACAAGACATTGTATGCGAAGTCGAGCATACGATCACTTGGCACTACTTGCTAAAATATCAATGAGTCATTACTTGCCGCTTTGCGTTTACTAATGTTCTAACTTTTCTCAGGCGAAATGTGTTTCTTGGACTGCACTCAGTATGTTATAATTTATTGATAAGGACAGCACAAAGAGAACGATTGGCGTCGCTGAAAAAAAAGGTGGACCACTAATTTCCCGGAGGAAGTATTGATTTTTAAGGGAAAAACAAACTTTGCGTGTTGGCACGCTGGTGATTTGAACTAGGATAGGCATCGGGTTAGGGGAAAGCGTTTTTACTGCCATTAGAGGGACATTTACCTTCATGGGTCAGTTACATGGTATTTTATCGCAGCTGAACGTTAGATAAGATCGACAGAGTTGACAAAGGATAACGTTTAGTAAATCCCTGGAGAAGGCCGTACATAACGAACCATTCATTTCCTGTCTTTCCCTTCCCACTCGGGCGTTGGTAGGTGAAAATTGTAAATCTTTTCGCCGGCGAGCAGCATGCGGAAGAGTTTCTTGCCATCAACCCGGAGCATACCGTGCCGACGCTGGTGGACGAGGACTACGTGCTGTGGGAATCGAAGGCGATCGTGACGTACCTGGCCGAGCAGTACAAGCCGGGCTGTTCGATGTACCCGAACGATCCGAAGAAGCGTGGCATCATCAACCAGCGCCTGCAGTACGATTCGGGTACCCTTTTCGCGGCCTTGCGCAACATCGTATCATCCGTGCTGCGCTCCGGGGAAACGGTTATCTCGCAGAAGCAGAAGGACACGATGCACCAGGCACTGGCGAAGCTGGAAACCTATCTGGACGGGTGCGACTGGGCCGCCGGGGATGAATGTTCCTTGGCCGATTTGTGCCTGCTGGCAAACGTTGCTTCGTTGAAGGAGATGGGCGTCGGATTCGGGACGTTCCCGAACATCAACGGATGGTACGAGCGATGCCAGATGTTGCCAGGGTTCGAGGAGAACAATGAAGGTGCCATCTTTCTCGGCAGCGCCATTAAATCGAAGCTGGAAGAACCGTACTAA
Ortholog: Anopheles gambiae | AGAP009342-PA | ortholog one-one
Aedes aegypti | AAEL010500-PA | ortholog one-one
Culex quinquefasciatus | CPIJ014694-PA | ortholog one-one
GO: GO:0005515:protein binding
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Down -2.24874783 6.19E-16 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Down -0.54277730 0.6756341541 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400