ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB39336.1'
Gene ID: ZHAS_00006696
Protein ID: KFB39336.1
Description: Glutathione S-transferases, Epsilon
Location: KE524975.1:3618805:3619557:reverse strand[JBrowse]
Sequence: >ZHAS_00006696  (675 bp)    All exons in this region
ATGCCGAACATCAAGCTCTACACGGCGAAACTAAGTCCACCGGGACGGGCGGTGGAACTAACGGCCAACCTGCTCGGTCTTCCGCTCGATATCGTTCCGATCAACTTGCTGGCCGGTGATCACCGGAGGGAGGAGTTTTTGAAGATGAATCCCCAGCACACGATCCCCGTGATCGACGACGACGGTATCATCATTCGGGACAGTCACGCAATCATCATTTATCTGGCGCAAAAGTATGACACAAAGGGAGCACTCTACCCGGATGATCCGGTGACGCGGGCAAAGATAAATGCCGCCCTACACTTTGACTCGGGCGTTCTCTTCTCTAGGTTGAGGTTTTACTTTGTAAGTGTTCAAACCAAACGCGCGATTCCATCGAAGGAAATGTGTAAGCCCTTATGCTCTTGTCCTGTTCCGTTTCAGGAACCGATACTCTACGGTGGTTCGTCGGAGGTGCCCCAGCATAAGATTGACTACATGAAGAAAGGCTACGAACTGCTGGACGGTGCGCTGACGGACGACTACATCGTCGGCAACCACCCAACACTGGCCGACATCAGCTGCATCGCGACGGTAGACACGATGGACATATTTTTCCCCATGGACAGAAGCAAATATCCGAAGCTGGTCGCGTGGATGGAGCGAATGAGCAACCGGATTCCGGACTACGACCGGCTCAACCGGGAAGGTTCGGTGGAGTTTGCTGAAATTTGCGAATCTTTGCGGCTGAACAACGCGACCAAAGTGAAATAA
Ortholog: Anopheles gambiae | AGAP009192-PA | ortholog one-one
Drosophila melanogaster | FBpp0085876 | ortholog many-many
Drosophila melanogaster | FBpp0291657 | ortholog many-many
Drosophila melanogaster | FBpp0293852 | ortholog many-many
GO: GO:0005515:protein binding
KEGG: Orthology:K00799
Pathway name:Metabolism of xenobiotics by cytochrome P450
Pathway map:ko00980