ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB39666.1'
Gene ID: ZHAS_00007116
Protein ID: KFB39666.1
Description: cytochrome P450, CYP 315A1
Location: KE524996.1:419253:421108:reverse strand[JBrowse]
Sequence: >ZHAS_00007116  (1323 bp)    All exons in this region
ATGCTCAACGATGTCATGCTCCTCGGAAAACCAGCTGAGTAAGAACACTTTATCTCGCGATGAGCAAACAATCGCATCCACCCTAAGCCGTGCAAATTAACAAATAATTCCTCTTGCGTTAGGTTGCATTTGCGCATCTCCAAGTATCACGATACGTACGGGGACATTTTCCGGTTGCAGATCGGATCACAGCATACCGTTTTCGTGCGCGATCCGGGTTTGATGCGGAAAACGTTTCAGCTGGAGGGCCCCTTTCCCAGACATCCGCTACCCGAGTCATGGACATACTTTAACAGAAAGTTTAACTTTCAGCGCGGCCTGTTTTTCATGTAAATGTCTTTGTATTTCGATCTAAGCTTTTTTACCAAAAGAAAGATTTATTTTGCCATTTTAGGGACGGGCAAGAGTGGCTACAGGCTAGACAAATTTTCAACAAGCCATTGCTGAAAGATTTTACCTGGATGGAACCGTTGATCCGGGCTGTATGCGAAACGAAAGTGAACGAAATTAAGAGTACCTGTGATAAAGAGGTTGCATTTGTAAATATTGAATCGTTCCTTTATCAATGGTCTGTAGAAGGTAAGGTAACTTGCTTAAAATAATGTAAAAAGTATGTTTTTATTAAATCAATTCCCTTTTGCTCTGGCTCGTACAGTGGTTTTAAGCGTGATGCTTGGTAAATCATTCCAACAGTGCCAAGCATCAGTCGAGTTTCGGAAGTTGATTCAGCAGTTCGCTCAAGTGGTGTATGAAATCTTCCGGCACAGTTCGGAGCTGATGAACATACCTCCGGCAATAGCGGACAAACTGAACGTACAAGCTTGGCAGCAGTTTGAAAAAGTAGTGCCTGAAACTATTCGTTTGGGTAGGTTAGCACAAGACCCATATAGCGTCGAGGAACTTTGTATTACAAACGCATCCCATTTCAGCAACTGAAATAATTGAATTTGGTATTCAGTACAAAAACGAAAATAGCGGCCTGCTAGATGTAATGTCGGAGAAGTTAGAGAAATCCTTGATGATGCGAATATTTATCGATTTTATTGTTGCTGCCGGAGACACGGTAATTATAATTTGTGAATACTAAATCCATCAAACTGCCAGCAAGCAGGTGGCCGTAGAATTAATAATTTTTGTTTTACATTGGCATAAAGACTGCTTTTGCTACCGTTTGGGCGCTTTATCTGCTAGCGAACAATAGTGACGTCCAACAGCAAGTGAGACGGGACGTGCAGGATTCAAATAGTTTGGAGTGTACTGCCATCAAAGGGGTTGTTCGCGAAACACTTCGTCTCTTCCCGATTGCTCCGTTCATTGGAAGATTTATTGACAATGATGCCGTGTTCGGCGAGTACAATGTGCCGAAAGATGTAAGTACTGCTCTTTAGGGTAATTCTGATTTGATTGCTGTGTTACTTTTTCCTTTTTTGAATCATTTCAAGACTCTTGTGTTACTGTCACTGTACAGCTCAGGAAGGGATGAACGGTTTTTCAACAACCCAGAACGATTCAACCCGTACCGTTGGGATCGTACTAATGCTCAAAACTCGTCCAACAGTACCACGGCTTCCGCTTCGTTACCGTTCGCTATAGGCGCACGGTCATGCATTGGGCAGAAAATAGCACAGCTACAAATGCACTACCTCCTGTCGATGGTAAGTCCCATCAAAGTAGAACAATTTTGAGCGGTACGTTTACGTATGGTATATGGTTTTCTTTCCCGTTTTCTAACATAGATACTCACGAAATTTGATTTGTCGATTCCCGAACATCAGCAGCATCATCAAATTAAGCCCATATTAAAGATGATTACGGTACCAAATATGTCTGTCAAAGTTGCATTTAATTCCATCTAG
Ortholog: Anopheles gambiae | AGAP000284-PA | ortholog one-one
Aedes aegypti | AAEL011850-PA | ortholog one-one
Culex quinquefasciatus | CPIJ012685-PA | ortholog one-one
Drosophila melanogaster | FBpp0081949 | ortholog one-one
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: Orthology:K10722
Pathway name:Insect hormone biosynthesis
Pathway map:ko00981
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 0.61530018 0.2783443792 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400