ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB40088.1'
Gene ID: ZHAS_00007557
Protein ID: KFB40088.1
Description: cytochrome P450, CYP 4G16
Location: KE525003.1:87790:93133:reverse strand[JBrowse]
Sequence: >ZHAS_00007557  (1698 bp)    All exons in this region
ATGTCGGCCACGATAGCCCAGGCGGATAGCCTCAATGGCAACGCCAACATCATCTCACCGATCAATATGTTCTACTTTCTGCTCGCGCCCGCACTGCTCCTGTGGTTCGTGTACTGGCGCCTGTCGCGCCGTCACATGCTCGAGCTAGCCGAAAGGATACCCGGCCCCAAAGGACTACCACTGATCGGGAATGCGCTCGATCTGGTGGGCAGCTCGCACTGTAAGTACTAGGAGCGTCCAGCAGTAGGGTGATCTCTCCGGTGTCTCGATTTTCCCACCAGACAGTGTCTGGTTAGTGCAGGATTAGGAAACCAGTCAAAGTCTGGACAAATACTCGCCAACTCCAAAGACTTCAAAAACTCCGTTTCCCGCTGCGCGCCTCTTTTTTCAATCCGCATGACAATTTCCGGCGGCTGAACCCATACGTCATACATCACTTGCAATGGCCGGCGTAGCGTATAAACGGCATAAATTGATGAGGGCGAGGGGAGTTTTGGGGAGGCACACACGAGAACCTAATTGACAGCTTCTTGGGCTGCTTCCCCACCGTGGTAATCTTTATACTTTGCTCTGCAACTCTTAGTATTGGCTCATACCCGGTTCGTCGTGCGTTGCTTCGTTTTTTTTTTCTTGAATTCCAACGGAAGCGTTAGTACAGCATCGTTCGTTATATCCACTAACACCAATCAGGTCTAATCAGAGCACGCGGGTGATTGACCCAGCATGGATCAGTTGAAAGGAAAGGAGTTGGAATGTAGTCAAAAACACGCTGTGTGCGTGAGTGTGATAACGCAAGGAAGTTGCCGGAGGAAGAGAGAGGATCAGAATGGCAGGCGAAGAGATAAAGAGAACCGAGATGATGTTTCATCTAATCAGGATGATATCAGACACTTTTAGATTGAACATTCTGGAACCACCGCTGGTTCCATGTTGAGCAACTGCAGATCATTATATCCATCAAGTAGTACAGCTTGACCTAGATAGTGCGTTCTTGGAACAGGTTTGGAACTATCATGCCATCGCAAACTAAGCTCCTTGGAGTAGACACCAAGGATCGCTAGCGCCTTACTTTACTTATATCTGTATACTGATCACCGAACGTTTTGGCGTTGTCCTACTATCTCCTTTCCCTTTCGGCAGCCGTGTTCCGCACGATCATCGAGAAGGGCAAGGACTACAACGAAGTCATCAAGATCTGGATTGGACCGAAGCTAATCGTCTTCCTGGTGGATCCGCGCGACGTCGAACTACTACTCAGCAGCCACGTCTTCATTGACAAGTCGCCCGAGTATCGCTTCTTCAAGCCATGGCTGGGCAACGGACTGCTCATCAGCACCGGTACGTACCCTCGTGGTTCGGTTCGCTTCCTTTCCGTGCACGCCGCTAATACTCTGTACGCAGAGCACCGGGCCACGAACGGCGCGCGAGCCACTTTGCGCTGCCCACGAAAGGCGAAAAACCAATTGACTCGAACCGCGGCGGCACGATTTGCATACATTTGCGCGAGTGCCGAGCACTGGCAGAGACGGTCCCCACTTGTGCGCGACCTCGCGTCGCGTGTTCCAACATCGCCCCGGAGGACCGGAAGCGGTCATTATCGCCATTCCGGTCACCGGTGCCGAATCCATCGAAAATCCCGGAACGGAACGGGCATGACACGTCCCGGCGGTTCGTGCACGCCCGCTAGTGCGTCAGCGTCGCTGTGGTCGCAATGGTTATGGCGTAAGCTGAGCGGGACTAACACGCAAAAATTAACATCAAGATGCACCGTTGTTCGTTCCCCCAAAACACTGGTAATGTTGGGAATCGTTAACGTTCTAGCTATTCTACGACTTTTTAGACCGATTCAGCTACTCAGCATTCGATAGTTCGATACTCGAGCGTTCCACTGGCTCGACAAGGATGGGCCAGAACGCCGAGTTGAGATCCGAGATTAATGTCGCCATCGCCATGACGGCAATTACTGCTTCCGCCTTCAATCTCAGCGCGCGTATTTTTATCCTTATTTCAATTACACTTTCCCCTTCCTGTCCTGTTTCTTCCACCGTCTGCCGCTAGGACACAAATGGCGCCAGCACCGCAAGCTGATCGCACCCACCTTCCATCTGAACGTGCTGAAGAGCTTCATCGATCTGTTCAACGAAAACTCGCGCCTGGTGGTGGAGAAGATGCACAAGGAAAATGGCAAGCCGTTCGACTGTCACGATTACATGAGCGAGTGCACGGTGGAGATTTTGCTAGGTAAGTAAGGCAGGCGCTAAAGAGTGCCCTTGCAACACCTCCGTAGTGTTCCTCCGCTATCAGCACATTCGCCAGGACAATTTCTGCGTGGTCTTGCGATGTTGAGCCACTCGATCGGAGTAAAACCGATTGGTCAACCACTGTAAGGAGAATGTCCGATTGGAAAGGGTTAGAAGTTGCTTAGAGCACCGATTGCGCCATTATGCGACGGTCGTTGCCCGAGATTTGCTAACGAGATCGGGCAAAGTTGCATAAGGAAATTCGCTATATGGTCATGCAAGTACCCTACGGCATCGCCAAGAAAGCACGGTGAGAGGAAAATTGCAGATGAACTGAAGCGGACCGCGAGGTAACTTGAACCTGCACTGGGCCAACGAGTTGCTCGGATGCCGCAATCCGTGTTCCAGGGCTCGCGCCGATTGCGACTCACCCTCTCCCCACCTATCGCTAGAAGCCTACGGGTGTGCTGTTTGTCATTTTCCTCCTGGCCGTGCGGCTAAGCTGTCCGCGCTGTCGCCCTCAAACCAGTTTCCCAGTTTTCACCCTGTCAACCGCAGGGCCTCTCTGCATGCAACCGCGAAGCTGCACCGCTCCTGCTGCACAATTGCACTCTTTCCTATCTCCTTTGCCATGACGTTAGATACGAGAAGGAACAAATCGCAGGTGGCGGTGGTGGAACACTTTCCATCGTTGCGCCAGCTGTTGGGTCCAGCCACACAAGACGTTACGCAATCGCTAGCGGTCATTACTCGATTTCAACACCGGTCACCGGGCTATGCTTGGAGCCAATATTCTACATCTCTCGGTGGAACGAACGAAACAGGGAGAGTTCAAATCTTTGTACAACATTTTGGAGGACATATCTCTCATTGCCGGCGCGTGTTTGTGCAACTTCCAACCATTTGCAATTCCCTCGCTAACGTTTTATGGAAATAAAAAAGCTCCAACGGTGTTGATCCGGCGCGGAGTGGTGCATATCATCATCGGGATAGAATGTAGCCAGCAGGCTCGTTGGGTCGGTTTTGATTTGTAGCTCTTGTGACGCACTAAGTCAGTAGCGGGAAACCACGCGCTCGCCCTAGTCCCTCTGATCCCGAGGTGAACCTGATCCAACAGGCTAGTCGCAGTTAAAGAATTCTAGAAACCCGAGTGCCCCGGGCCCGGCTTCGACTTCCTGCTCGCATAGTCATCAGCCGGGGTTCGGTTCACCGGTGAATCGTTAAATTTTAATTCAATTTGCAAATCACTCGCCGTCCGACCGTCCGCGCACTATGCCCCGATTAACCCGCCCTGATATGCGTTAGTACTCCCCCCGACCAAGCCGTTTGTCGTTTTATTTGTTTTCTTTTTTAACTGCTCAATCACTGTATGTCTCCTCCCGGGTCTGTCCGCGGGTCCGACGCGAGTGTCCCCTATGGCGAAGCGCGTGTGGTTTAATTTCATTACCGGTAAAACTGCATTACAAATGTCTCCTGTCTTTATGGCACTTGTCGTCTTGTTGACATTTTCGCAAAGGTAGCAAAGCAAGGTAGTTTTCCTTCACTCCTTCCAAGAATACATGAGTGAAAAAGTGGGGTTAAAAATTAAGAACTTGTAAAACATGAGTTGGAGAAAAAATTTGACATTTTAAGTTACGCTTAGGGACTACAACAATGCTCTGAAATATTGCGCATAAAAAATGAGCCTGAAACCTCCACGTCCTCCGGGATTACAAATAACTCTGACCACTGATCTTTAAATATCTCTACCGGAAGAAGTCAAATCCCACTAAAGAATATCGTACTAGACTCCTTACTTTATCCAGTATTCAGAATTTAACTAATAATGTTGACACGCACCCCAAACATTATAGTATGTTACCTCCATCCAACTGTTGTTAATCAATTTTCTTGTTTCAACTCAACCACCCGTGCTATCCTTAAAGAGACCGCCATGGGTGTGTCAAAGAAGACCCAAGATCAGTCCGGATATGACTACGCCATGGCAGTGATGAAGATGTGCGACATTCTGCACCTGCGCCATCGCAAGATGTGGCTCTACCCGGACCTGTTCTTCAACCTGACGCAGTACGCCAAGAAGCAGGTGAAGCTGCTCGACACCATCCACAGCCTGACGAAGAAGGTCATCCGCAACAAGAAGGCAGCGTTCGACAAGGGAACGCGTGGCTCGCTGGCGATCACGTCGATCAAGACGTCCGAGCTCGAGAAGCCGAAGGGCGACGCAGCCAAGACCAGCACGGTCGAGGGCCTGTCGTTCGGCCAGTCCGCCAACCTGAAGGACGATCTGGACGTGGACGAGAACGACATTGGCGAGAAGAAGCGCCTCGCGTTTTTGGATCTCCTGCTGGAGAGCGCCGAGAACGGCGCGCTGATCTCGGACGAGGAGATCAAGAACCAGGTTGACACGATCATGTTCGAGGGGCACGACACGACGGCCGCCGGCAGCAGCTTCTTCCTCTCCATGATGGGCGTGCACCAGCACATCCAGGACAAGGTGATCCAGGAGCTGGACGACATTTTCGGCGACTCGGACCGGCCGGCCACGTTCCAGGATACGCTCGAGATGAAGTACCTGGAGCGCTGCCTAATGGAGACGCTGCGCATGTACCCGCCGGTGCCGATCATCGCCCGGTCGCTGAAGCAGGACCTGAAGCTGGCGTCCAGCGATCTGGTCGTCCCGGCCGGAGCAACCATCACCGTGGCCACCTTCAAGCTGCACCGCCTAGAATCGATCTACCCGAACCCAGACGTGTTCGACCCGGACAACTTCCTACCCGAAAAGCAGGCCAACCGACACTACTACGCGTTCGTGCCGTTCTCCGCCGGACCGAGAAGTTGCGTCGGTAAGCAAACCCTTCTACAGCTTGCCGTATATAGTAACGACGCTCGTCATTTATTGACTTACTATTTACGCCATTCTTTCAGGACGCAAGTACGCTATGCTGAAGCTGAAAATCATTCTCTCGACCATCCTGCGAAACTTCCGTGTCCACTCCGACCTGAAAGAGGAAGACTTCAAGCTACAGGCTGACATCATCCTGAAGCGAGAGGAAGGCTTCCAGATTCGTCTCGAGCCGCGCAAGCGCAAGGCGAAGGCACTTTAA
Ortholog: Anopheles gambiae | AGAP001076-PC | ortholog one-one
Aedes aegypti | AAEL004054-PA | ortholog one-one
Culex quinquefasciatus | CPIJ009415-PA | ortholog one-one
Drosophila melanogaster | FBpp0073352 | ortholog one-one
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: Orthology:K15001
Pathway name:
Pathway map:NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 1.96931815 0.0046395359 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 0.05668914 1 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400