ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB40226.1'
Gene ID: ZHAS_00007603
Protein ID: KFB40226.1
Description: Glutathione S-transferases, Theta
Location: KE525003.1:1366432:1367216:forward strand[JBrowse]
Sequence: >ZHAS_00007603  (714 bp)    All exons in this region
ATGTCTGGAAAACTTAAGCTTTATTACGACTTCCTGTCGCAACCATCAAGAGCTCTGTACATATTTCTGTCCAAGAACGAAATACCTTTCCAGCGATGCCCAGTAGCGCTGCGAAAATGTAAAAACAGCTTATGAAAATAAGAGAGGTTTGGTTTTACTCACACCTGATTTTATCTTTTCGCACTATAGTTGAACAGAAGTCGCCCGAATACAAAAAGAATGTGAATCGCTTCGGGAAGGTTCCGTGCATCGTTGAAGATGACTTCCGTCTCGCAGAAAGCGTTGCTATCGTTCGTTATATCTGCCAGAAGTACGACGTGCCATCATATTGGTACCAAACAAACAATTCCATAGGACAGGCGCGTATAGATGAATACCTTTCCTATCAGCACCTGAACATCCGAGCCGACGTTTCGCTATACTTCTTCTACGTTTGGCTGAATCCGCTCACCGGCAAGAGCGTAGACCAGGAAAAGGCAGCACGCTTACGGGCCCGGTTGGACAAGGGGTTAAACTTTTTCGAGCAAGTGCTGCTGGACAATGGCAACAAGCCTTTTCTGACAGGTGATCAGTTCACCTACGCGGATCTATCGGCAGCCTGCGAAATAGAGCAGGCAAAAATTGCTGGATACAATCCGTGCACCGCTGACCGTCCGCATTTGAGCAACTGGATGGCGGCTGTCCGCGAGAGAACCAATCCGTTTTATGATGAGGCACACAAGTACGTGTACCGGCTAACACCGGAACATATTCCGACCCCGGCTGTTCCGGCTGATGACGATTGA
Ortholog: Anopheles gambiae | AGAP000888-PB | ortholog one-one
Aedes aegypti | AAEL009016-PA | ortholog one-many
Aedes aegypti | AAEL009020-PA | ortholog one-many
Culex quinquefasciatus | CPIJ014053-PA | ortholog one-many
Culex quinquefasciatus | CPIJ014054-PA | ortholog one-many
Drosophila melanogaster | FBpp0087548 | ortholog many-many
Drosophila melanogaster | FBpp0087549 | ortholog many-many
Drosophila melanogaster | FBpp0289447 | ortholog many-many
GO: GO:0005515:protein binding
KEGG: Orthology:K00799
Pathway name:Metabolism of xenobiotics by cytochrome P450
Pathway map:ko00980
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 0.19351216 0.6472807893 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400