ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB40593.1'
Gene ID: ZHAS_00008108
Protein ID: KFB40593.1
Description: AGAP002994-PA-like protein
Location: KE525031.1:6321:6979:reverse strand[JBrowse]
Sequence: >ZHAS_00008108  (588 bp)    All exons in this region
ATGTCTTCAAAGGTTTGTTCGCAAGCGTGTTGTTGGAAAGTACAGGAGTTGGGTTTGATGCCTCTGCTCATCCTCATTACCAGATCTCGCTCATCGCCGTCGGGCTGCTGCTGGTCGTTGCCTGCTCCGACGCACAGCTGGGATCCCGACGATCGTCTCAGGAGCGGGCAGGAATCCTGCGCCAGTACGACGACGGTCTCCGGGCTTCCCGTAACTTCGACGATCTGTACGACGAGCAGCGCTTCACGCAGGGTACCCGCAACCAGCAACAGCAGGAGCAGGAGCAGCGTCAGGATCGTCGCGATCGCACGGACTACGACAGCAACGACGACAGCTACAGCTACGGCTACGCAGTGCGTGATGAGGTCTCGGGTGACATCAAGAGCCAGCAGGAGGTCCGCAACGGTGATCGGGTTCGTGGCCAGTACCGGACGGTGGAGTCGGACGGCACGGAGCGCATCGTGGACTACACGGCCGACGACTTCCGTGGCTTCAATGCGATCGTGCGCCATCAGCCGCCGGTTGCCAAGCGTACTCAGCTCGTGCATACGCTTCAGCCGGCCGTTCTGCTGCGTCCAGCACACGTTGCCCAGGTTGTGTCTGCCAACGGCGTTGGCCACCGCTCGGTACCATCGGCTACCGTCCTCCTGCATAATTAA
Ortholog: Anopheles gambiae | AGAP002994-PA | ortholog one-one
Aedes aegypti | AAEL004994-PA | ortholog one-many
Aedes aegypti | AAEL013511-PA | ortholog one-many
Culex quinquefasciatus | CPIJ013785-PA | ortholog one-many
Culex quinquefasciatus | CPIJ017736-PA | ortholog one-many
Culex quinquefasciatus | CPIJ019699-PA | ortholog one-many
GO: GO:0042302:structural constituent of cuticle
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Up 1.76731622 0.0033285022 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810