ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB40849.1'
Gene ID: ZHAS_00008372
Protein ID: KFB40849.1
Description: AGAP011507-PA-like protein
Location: KE525041.1:377989:380044:forward strand[JBrowse]
Sequence: >ZHAS_00008372  (1839 bp)    All exons in this region
ATGGGCGCTGGTTTAGTGTATCTTCGATTACTTACGATAGTTGTTAGTCTTCTGTACGCTCACCTAACATTCGTCACTGCAGATGACATCGAAAACACATCGACAGATTGTACTATTCAGCTAGGACTTCAATCCACAGGTCAAGGCGTGCGGAATAGTACCTTTAATGCAGTTCAATTTTGTGAATATCTTGGCATTCGGTACGCAAAGCCTCCGATTGGGTTACTTCGGTTTGCAGTAAGTTGTGAACGAACGTAACATTTTGTAACATTTTATCCCATAATCGAGAATTTCTGATTCATAAACATAAACAATAGGATCCAGTGTTCGAGGAACCAGAAGGTCACAACAACTACACCGCGTATGGGAACAAATGCCCGCAGTTTGATGATATTAACGAGCAGACATCCGTGATCGGAGTGGAGGACTGTCTGTTTTTGAATATTTTCACAACAGTGAACAGCACGACTAGTCGAGATGGTAGCGATCGGCTGGTCATGCTCCCGGTGTTAGTGTTCATCCATGGTGGTAGTCACGTGGCTGGTTCGGGTGAAGTTCACGGCGTCGATTTGCTTATGGAAAATGTTCGTATAGAAGATTCCACCAATCATGAATTTCAACAGTGTTTACCATGAATTCCGTGCTTAATTTTGCAGGATGTGATCGTAGTAACCATCAACTATCGACTTGGAGTGATTGGATTTTTGAAGGATGAAAAGCACAACATCACCGGAAACTATGGATTGAAGGATCAACTCCTGGCTCTCCAATGGATACAGCGCTACATTGGTTATTTCGGTGGGGATCCAAATCGTGTCACGGTCATGGGACACAGTGCTGGCGCTGGTGATCTCTCCCATCATCTGTATCACGATCGCGCACAAGGATTGTTTCAGGGAGCCATTCTCCTAAGCGGTTCGATGCTTGCACCTTGGGCGTTGCTCTACGAAGGCGAACAGTGCATGGATAATTATCTGCGAGACCTCAGCGCGTCGACACTGGACGAGCTTCGGGAGCAATCATTTGAGGAGTTTTTCCTGAAAGATAATAGACTCCGACACACATTTGCCTTCTCCAGTATGTTCTATCCATGTTTCCTTCCAACACTAGAGGATCACTTGACCGATGAAGCATCATACTTCAGTCAATCCCCTCATAAGACCGTTCGAAGGAAGACTCCCCATCCGATGCCGATCCTGATGAGTGAAACCTCCACCGAGTTTGAGCTTATGCTGAAGCATGTGTCGGCCTTCTGGATGAGCAATAATTACCCCAACAATGGATGTCGGGAGCTGAAGCAACAGATTGCGGAAATTTTCGAAAACATTAGCATATGGATGGTCTCGGAAGGGTTGGAAGCTTCACGGAGCCAATTCTATCGCAAGATGGCCAGCATGGCCAACCTGCATTATCCCATCAAGCGGTTGTTAAGCGAGTTCGTACAACGGTTGGACACCGAGCAGATTTACTATTTGCGCTTTGAGTTCGATGGAAAGTTTGGAGAATACAAGAAGAAAATATTTTCCCAATACGTGGACAACTCGGTGTACGGTGCGATCCACGGAGACGAGCTGGGCTACATTTTTAGCCCTTATAACCTGAAGGAAGCGGTCGGAAATCGGAGCGAATTCCGTCGTGAACTATCGGTACACATCAAAACAGTGGAGCTGATAACCAATTTTGTGAAATATGGGTAAGTCTTGAAAGACACACTTACTGAACAGTATTCTTCATAGAACGATTTCCATCTACTTCTAGAAACCCGACACCAAAACGTAGCAAACTTTCTGATCTTGTCTGGCCTTCGTACAGCGAGTCACGTAATCAAACGCAGTACCTGAACATAGACGAAGAGTTTCAGGTGCGAGACGTCGAAGATCGACGAAATATTTACTTTATGATTTGGCGACTCATTTACGAATGCCTTTACTACGCAAAATGCGAGGCGCTCACGAAACTCCGCCTGCTTTCGGAGAGTTACACGGAAGAAAACACTGTTCGCAGTGAGGAATATGGCGAGGAGCTTGCGGAGCAGTTAAAAGATTACTTTACTTAA
Ortholog: Anopheles gambiae | AGAP011507-PA | ortholog many-one
Aedes aegypti | AAEL000530-PA | ortholog many-many
Aedes aegypti | AAEL000546-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016681-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016683-PA | ortholog many-many
Culex quinquefasciatus | CPIJ017763-PA | ortholog many-many
Culex quinquefasciatus | CPIJ019485-PA | ortholog many-many
GO: NA
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Down -0.25390711 1 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400