ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB42430.1'
Gene ID: ZHAS_00010129
Protein ID: KFB42430.1
Description: cuticle protein 7
Location: KE525185.1:352861:353256:reverse strand[JBrowse]
Sequence: >ZHAS_00010129  (396 bp)    All exons in this region
ATGCAGTACTTCGCCCTGTTCGCCCTCGTCGCCGTCGCCAGCGCCGCTGTCCTGCCAGTGGCCTACAAGCAAGTCGAGTACGCCGATGCTCCGGCCGAGTACCAATTTAACTACGAAGTGCACGATGACCACACCGGAGACATCAAGAGCCAGCAGGAGCAGCGTCACGGAGACAACGTTGTCGGACAGTACACCCTGATCGATGCCGACGGATACCGCCGCGTCGTTGACTATACCGCCGATGAGCACAACGGATTCAACGCCGTCGTCCGCCGTGAGCCTCTTGGACAAAAGGTGGTGAAGGCCGTCCTCCCGGTCGCCAAGGTCGCCGTCCCGGTAGCCAAGGTGTACTCCGCCCCGATCGCCAAGGTTGCCATCCCCTCGTACCACTATTAA
Ortholog: Anopheles gambiae | AGAP010099-PA | ortholog many-many
Anopheles gambiae | AGAP010100-PA | ortholog many-many
Aedes aegypti | AAEL004742-PA | ortholog many-many
Aedes aegypti | AAEL004748-PA | ortholog many-many
Aedes aegypti | AAEL004760-PA | ortholog many-many
Aedes aegypti | AAEL004764-PA | ortholog many-many
Aedes aegypti | AAEL004765-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013762-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013763-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013764-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013765-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013767-PA | ortholog many-many
Drosophila melanogaster | FBpp0079492 | ortholog many-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA