ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB42433.1'
Gene ID: ZHAS_00010132
Protein ID: KFB42433.1
Description: hypothetical protein ZHAS_00010132
Location: KE525185.1:360490:366551:forward strand[JBrowse]
Sequence: >ZHAS_00010132  (648 bp)    All exons in this region
ATGTTCCTCAAGGTAAGAAATAAAGCCAAATAAACCATTCTCCCATCAGTTACCATCACTAAGAATGATTCGTTTCATGGTAGATTGTAAGCTTCATTGGTGTGTTGGCTGCCGTCGGAGCCCAGAATCACTATGGTGCGCATAACGAAGTGCAACATGACGCCGGCCATTACCATCACGACGAGGAGCACCATGGACCAGCGCACTACGAGTACCACTACGATGTGCACGACGAACATACCGGAGACGTGCACGGACAGCACGAGGCCCGGAAAGACGATCACACGCACGGCGAGTACTACCTGATCGACGCCGATGGCCACAAGCGCACCGTCAAATATAAGGTCGAGGGCAAGAGTGGTTTCATCGCGGAAGTGCACCGCGAGCCGGTCAAGGGTTTCCACGATGCTCCAGCACATCACAATTTCCACCACAAGTTCGAGGATCAGTACTAGTGCTAGGGTCTTTCAATTCTTAGTTCGTAACAATATTAGTCAGCAGGACTTTTTGTAAGCAATAAATTAAACGAAATGAAACACATTTATCAATGACGGTGATCTTCAGTTGCTGTAGCAAAATGCCAAAATGATCTCGAGTAAATACTTAAAATATTTCTCATATTCAAAACTTAGACGAGCCTCTACTGACATACTTTCTTTAGCATACAACTAACACGTGCCAATAACCTTCACGAGCTTGCGCAAATACAGGATTCGATCGTCTGGTTGTTCCGAGCCATTCAAAACTTTCATATGCGTAGAGTAACCGGTTCGGAATTTTAGTTTTTACATTGGCTATCGAGCTATGGAGGCCCATTCTATCTGCGTATATAAAGAAAAGATTCAGCTTATTCGTCACTCACATTCAATCCGATCGTCGTTCGAGCAACTAACAATCCAGTGCATATTCCTTGATCAAACATGTACACCAAGGTACTACTCAATCTTTTTCGTCCAATTTTAAACATTTACTAATGAATTGTACACCCTCGACAGATCATTGTTGTCCTAGCCGTGTTCGCCGCCGTGAGCGCGCAAAGCCACTATGGCCACCAGGAATACCTACAGCCCCAACACTACCATCATGAGGAGGAGCATGGTCCCGTCCACTACGAATACCACTACGATGTGCACGATGACCATACCGGAGATGTGCACGGACAGCGCGAGGCTCGTAAGGACGAATCCACTCAAGGCGAGTACTACCTGATCGATGCCGATGGTCATAAGCGCACCGTCAAGTACCACGTAGAGGGAAAGAGTGGATTCATCGCCGAAGTCCAACGTGAACCCATCAAGGGATACCAGGCACCTCAGCCCAAGCACTACCATTAAAGTAATGTTATAAGCAAAATGAATATGTGATCTTAGAACAATTTTCAGAAATATAAAATTAATTACATCAAAATCAGTGAGCGTTCGTTAAATAGCAAGGGAAATTAACTTCCGAAAAATAATAGTCAATATTACTGTCAAATATCCTCAATCGTATCGTATAGGATAAGTTGTACCATAGTGGTACTAGTACCAATAGTGGAGGTAGTGGAATAAAATCCTAGTTCTACCAAGAAATAAATTCAATAGCGTTATTTGTACTAGTATAAATTTTCTTTGATATTTTACGGCGTGTTTAAAAGATACACCTCAATTTTTTTTCCAAACAGGTTGCACTAATATGCTGGTTTCGTTAATAATGTTTCAGAGGTCCCATGATTTACTGAAGGCTATAATAAATCACCACAAAAATATTGGTTTATGAAACCAGTGCATCGGTCTATAACCAAAACAAGGCATTGATCTACGAGAAATTTTACCGTATTATTTCAAATACGCTTCAAAAATAAATTACAGTCGAATTATTATTCCGTGTTTATCAAATTTTCTGTACTACCACCACTATAGGCACACGAAACAACCACTATAGGAACCATTAAAGGAACAACCAGCTAAAAAGAAATTTACGTTTTGTTCGTGTATTTTTCATGATAAACGGTGAAAATATATATTTTGTAGAAGTATAATGGTACAGATACCCTTCCCATAAATGCATATTTTACTTTCGCAATCTAAACGAAAATAAAATGGTATGCCTTATGTATCAGATAATTCACTGCAACTTGATGATCTAGAAAAGTTTGTATTATTTTATAATCTGGAAAAAAACCTCTGGAAACATGCCCTCCTTCAACCAAGAGTTTTATTTTAACGATTAAAATATTTATAAGTTCTTTCTGTGGCAAAAATGATAGAAAAGCAGTACACTTATAATGGATGGTTTAAATTTTGAGCATATCTAGGGCACTATCACATACCTCAACCAAAACTTTAATTAACTTGTGGTGTGATGAAAGAAGAGTGAGTGGATTACTTCTGTTAGAATTCGTCCCAACGAACACGAAGAAACAACTACTAAAGCACATCGTTAGGAACGCTAGATGGAATGAACGAAAATTTTGTCTTTATTCGTACACTATTTTTAATGCAACTGCAGTTTTCATTCTATTTATCTCTTCGATCAGGTGTCTTGGCAGCCCTCAAGGATTATCGATCCTTCGATCTCTGCGCCTAGCCAGTTAGGTGTGGGTTTTTTCGCCTAGATTTCGTATGACACATGCCTAGGATTTGATCGAGCATCGATGCTTAACGATGTGACTTTTACAATGACGATGTTCTAATTTACAAAAAACGTAACAATAGTTTGCATACTCATCTAGGAAAATTATTAGTACATTGGCATCAAACAGCCATTTAAATTCCTAAATTTTCTTAAAATATTTAATTAATCACCAATAACTAACATGATGGTTTTGAAATTTAAACTAATATTAATAACCTCACGCCTATACCACGCCTACAACTACAGGAAGCGTTTATCGTTCAAAGCTTAAATACGCAACAAAACTAGACGCAGTCGAAAAAACATGAAACGTATTTGAAGACATGAAAAAATTAAACAAAATAAAACATTTTGAACTACAAAAAAATGCTTATGTATGTATGAAACACAAAACAATCATAGTATATAAAATGATTCCATGGCAATGAACTCAACCTCATTTCGGTTAATCGTTTTTGCTATCGGTCAACGTGTTTTTGGTTTAACTTATTCCGTTTTTCTAAAACATGTAATTTACCTGATTGAAAATCCTTTCACTGCAAGTAGAGCGATCTGGTTCAACCGGTTGAAATATTGGCGCCAATTTGACCATATCTCCTTCCTTTGAATTTTGCATTTCTGTATCTTCTGTTCCTTTCCCTGCCAATTTGCTTATGCTGCCTTTTCCAAAACCACCTCATATATAAAGAAAGGAGTCACTGTGGTTGCTCTATCAGAAAGCATCGCCCCTTCATTCGAGCAACACTGTTTGCAATAGCACACATTATTTCTCAAAATGTACTCCAAGATCATTGTTGTCCTAGCCGTCATCGCTGCCGTGAGCGCGCAAAGTCACTATGGCCACCAAGAATACCACCAGCCTCAGCAGTACCATCATGAGGAGAAGCACCATGGTCCTGTCCACTACGAATACAACTACGATGTGCACGATGACCACACCGGAGATGTGCACGGACAGCGCGAGGCTCGTAAGGACGAATCCACTCAGGGCGAGTACTACCTGATCGATGCCGATGGTCACAAGCGCACCGTCAAGTACCACGTCGAGGGAAAGAGTGGATTCATCGCCGAAGTCCAACGTGAACCCATCAAGGGATACCAGGCTCCTCAGCCCCAGTACCACCACAAGGCACCTGCCCACCATAACTACCATCATTGAAGTCATGCAACACTAGGTTAAGTGAAAGTAGAACCATTTTTAAAATATAAGTGTGCGTTGTATAAAATCTAAATGCTTTATTTTGTTTTATTTTATTTTGTCATTGAACTACGCATCTAAAGGTCACATGGCTATCAACAGGAATATATTTTCAAGTAAATGTGTCTCACCTTTCTAAAATTATTGTCTAATAATTTTCGAAACTCCGAAACTTTTCGAAATATATCCTTGCAGATACGAAAAAACGCTAGCAACTCTCTTTTAAAAGCACCATCAAGTATTTTATTCCTTTTGTATTCAGCACAACATTGAATTCAATCGTTTAAATTGAATTAACTGTGGCCAAAACTCTAAAAAAAACTATGTTTAAACGTTTATTCGCACTTTCAGCTATATAGCCATAGTAAATTTGTTTAAACACCAAGCTTAGTGGATTTTTACTATTCTGTCACATACGGAGAAAGGTTAAAAATTGGTTTGTTAACCAGGTTCCGGCCACAGAAGAACTAACCACAATGTACAAGAGAGGCCGAACCGTCAGAGAGAAGGAAAATGGCTTAATCACTCTGATCTTCCAACCAGATCCAGAATAGTTGAGAGCAACATAAAAAAGATGGACATTTTTATATAAAAGCGTCGATACTGAATGATAATGAATCATGTACAAGGATCATTGGAGCAGATGAAATATTTAATGTCATGACTATACCTAACACTGTTCATTCTCTTATTATAATAAAAATTCTAATTTTCTTTCAATTGTAAAAAAAAGCCATAGACGTCGGATCTATTCGAACAATTTGAAAGCCCAATTGGTGCAGCAGGTGGCCGAGTAACAACCATAGTTTTAATGCTAATTTACATTGAAAATTACTTGATTTAAATATCTTGCATAGTTTTCTGTAACTATCGCCGAAAAACCTGTGTGTATTTTTTAACACAATCACTAATTTAATTCACAAACCTTACGCGGCTTTATCGGTATTTAGCCTACGAGAGAAGCGCATGGTTGTACACGCTTATCAAAGGTTATTTTTCTGATTTAAGGAAATTGATTTATTCTGGTGGTAAGACTTTTCTAGAATAAACCAAATTCACATAACATATAAGGTATCAATCACTAGAAATGTAAAAAACATGCGAGTATGCCAGTAGGTGTTTGTAATCAGTCAAACATTATTTCACTAGTTAAGATGCAAATAAGTATCATAATTTTTAACAGCTGCTGTGATTGTAACAAAAATGCAGAGAAGATTATTTTTGTTGCCTATTAATATCACAACAGGTATGAATTTACAATTTGTAATGAACAGGTGAGTGGTTTTTAGTATTATACTTATCCAATTTTGTTAATTGTTTGTTGTGCAAGGTTGCACGTTGGAAACTGAATTTAAAGCTTTACCATATTATCATAAAATAAAATAGAAATGTTAAAAACGACCAATATCAAGGAAAATAGTTCTCCATACGCTACACTATATCAATTTAGCACTTTCTTTTAAAAAGTCAAAATTAGTAAATTTCATATCCTTGACATTGACATTTTTTTGTTTTATGTCGAAAAAAGTATCATACGTATCTGAACAAGTTCCAACATTTTTACATAACCAGGACCATGTGCCTTTCACTTAAACAACAGCTGCTTACCGGTTTAGCCGGTTAAATATTTGCAACAAATTTACGGAACAGCTTTGTTCGATTAAGCGCGTGGCTGCTTTTCTCTTAGGTATATAAAGAAAGGATCCTGTTCACCTCTTTTATCAGAATTCATTCGTCAATCATTCAAACAACTCAGTTCCCGTGCTTCTAACAGTTGATCTTCAAAAAATGTATTCCAAGGTACAGATTTAATTCTCCCATTTTGCTAAGCATATCCGAACTGAAAATTCTTCCTCACCAGATCATTGTTGTCCTAGCCGTCATCGCCTCCGTGAGCGCGCAAAGCCACTATGGCCACCAACAACACCACCAGCCTCAGCAGTACCACCATGAGGAAGAGCATGGTCCCGTCCACTACGAATACCACTACGATGTGCACGATGACCACACCGGAGATGTGCACGGACAGCGCGAGGCTCGTAAGGACGATTCCACCCAGGGCGAGTACTACTTGATCGATGCCGATGGCCATAAGCGTACCGTCAAGTACCACGTCGAGGGAAAGAGCGGATTCATCGCCGAAGTCCAACGAGAACCCATCAAGGGATACCAGGCTCCTCAGCCTCAGCATCACTATCAGCCCCAGTACCACCACGAGGCTCCTACCCACCATAACTACCAAAATTAA
Ortholog: Anopheles gambiae | AGAP010102-PA | ortholog many-many
Anopheles gambiae | AGAP010103-PA | ortholog many-many
Anopheles gambiae | AGAP010104-PA | ortholog many-many
Anopheles gambiae | AGAP010105-PA | ortholog many-many
Anopheles gambiae | AGAP010106-PA | ortholog many-many
Anopheles gambiae | AGAP010107-PA | ortholog many-many
Anopheles gambiae | AGAP010108-PA | ortholog many-many
Anopheles gambiae | AGAP010121-PA | ortholog many-many
Aedes aegypti | AAEL004747-PA | ortholog many-many
Aedes aegypti | AAEL004752-PA | ortholog many-many
Aedes aegypti | AAEL004759-PA | ortholog many-many
Aedes aegypti | AAEL004771-PA | ortholog many-many
Aedes aegypti | AAEL004772-PA | ortholog many-many
Aedes aegypti | AAEL004782-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013768-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013769-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013770-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013771-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013772-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013773-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013774-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013775-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013776-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013777-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013778-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013779-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013780-PA | ortholog many-many
GO: GO:0042302:structural constituent of cuticle
KEGG: NA