ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB42439.1'
Gene ID: ZHAS_00010139
Protein ID: KFB42439.1
Description: AGAP010122-PA-like protein
Location: KE525185.1:385782:386942:forward strand[JBrowse]
Sequence: >ZHAS_00010139  (1101 bp)    All exons in this region
ATGGCGATAAAGGTAGGAATAGCTCTGGCGAAAAACATTCATGTACTCATCGTTTAATCCATCGCATTCCAGTTTACCCTCTTCCTGATAGCGGCAGTCAGTGCTGCGAGTCTACAGGACTACCAGCAGCACCAATCCCAGCAACACCAACAGCCACAACAGCAACAGCACAATCAAGCGGACCCGTGGGAACTGAAGCGATACGCAGCCGAAGCACAGGGCCAGAATGAAGATTCAGTCGGTTACGACTTTGCCTACTCCGTACACGACCCGGTGACCGGCGATCAGAAGAGCCAGGAAGAATCGCGTCGCAATGGACACGTCCGGGGTCAATATTCGTGGGTCGATGCGGACGGCATACGGCAGATTGTCAACTACCGTGCCGACGATCGCAACGGTTTCAACGCGGAGCAACGACGCGAGCCCGCTCAACGACCAAGATTGAACCGTGTGTTCCAGTTTATTCCAGCTCAAACGGTGGCGCCACTGTACACGATCGATACCATCATTGCACCGGCGTACACCTCCGTTTCCCGAGTTGACCAGTTGCGCCGACGCGATCAGGCACCTCGTGATGGACGGGATGAGACAGGCGATAACGATCGAGATGAACGTGGCAACCGTCGGGACGAACTAACCGAGCAGCGCGACGAGAAACGTGAGGATCGGCAGGATGAGGTGCGTGACGAACGTCGTCGAGGTGATCGGCGTGAGGAACGCCGGGAAGAGCGACAGGACGATCATCAGCAAGGACGCAGGGAGGAGCACCGTGAGGACCGACAGGAGGAGCGCCGGGATGACCACCGCGAGGAACGTCGTGAAGACCAGCATCAGGACGAACGCCGAGAGAACCACCGTGAGGATCGTCGTGACGAACGCCGTGAGGATCGCCGAGAGGGTCGCCATGAGGAACGTCGCGACGAACGCCGCGAGGAACGCCGTGAGGAACGTCGTGAGGAACGTAGGGACGAAAACCGTGATGAATCTCGTGACAATCAGGACAATCGACGCGACGACCACAGCGAAGGACGACGCGAAGATGTGCGGGATGAGCGTCGTGAAAACAATCGTGACGAACGTCGTCAAGATGGCTACCAAGCTGGTGCACAGTCTGAAGTTCGATTCCATGCTCCATCGGTGACCTATCAGTACAGTAACTGA
Ortholog: Anopheles gambiae | AGAP010122-PA | ortholog one-one
Aedes aegypti | AAEL017262-PA | ortholog one-one
Culex quinquefasciatus | CPIJ013782-PA | ortholog one-one
Drosophila melanogaster | FBpp0079865 | ortholog one-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Down -6.59259033 4.94E-168 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 0.38841555 0.0341130861 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400