ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB42450.1'
Gene ID: ZHAS_00010151
Protein ID: KFB42450.1
Description: AGAP010116-PA-like protein
Location: KE525185.1:422681:423435:forward strand[JBrowse]
Sequence: >ZHAS_00010151  (693 bp)    All exons in this region
ATGGCATTCAAAGTAAGAATCAAAAATGATTTCAAATAATTGAGGTATTCCTAACATAATCAAACTATTTATAGTTCGTTCTTCTGGCCACTTTGGTCGCCGCCGCCAGCGCTGGTCTGCTTCCGGCTGCTCACCATGGCTCCATTGCCACGTCGCACTCCACCATCCAGCACCATGCTGCCCCCGCGGTCCACCACGTTGGAGCCATCCACGCCGCTCCGGCTGTGTACCATCACCAGCCCACCATCGTCAAGACCATCGCTCAGCCGACCATCCTGAAGTCCTATGGACATCATGAGGACCACTACGACCACCATGCTCCGGCCAACTACGAGTTCTCGTACTCCGTCCATGACGAGCACACCGGAGACATCAAGAGCCAGCACGAGACGCGCCACGGAGATGAGGTCCATGGCCAGTACTCGCTGTTGGACTCCGACGGTCATCGCCGCGTCGTCGACTACCACGCCGACCACCACTCCGGATTCAACGCCGTCGTCCGTCGTGAACCCACTGGAGTGAAGATCGCCCAGCCAGTGCACAAAGTGATCGCTCAGCCCGTCCATGTGTCCAGCTACGCCCATGCTCCGGTAGCTCACGCCACCATCCAGCACCATCATGCTGCCCCGATCGCCCACCATGTTGCCCCGATCGCCCACTATGCTGCCCCGATCGCGCACCATGCTGCTCCGATCGCGCACTCTTCCTCCAGCATCGTCCATGGAGCCAGCCATCTGAGCCATCATCATTACTAA
Ortholog: Aedes aegypti | AAEL004745-PA | ortholog many-many
Aedes aegypti | AAEL004746-PA | ortholog many-many
Aedes aegypti | AAEL004749-PA | ortholog many-many
Aedes aegypti | AAEL004751-PA | ortholog many-many
Aedes aegypti | AAEL004758-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013786-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013787-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013788-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013791-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013793-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013794-PA | ortholog many-many
Culex quinquefasciatus | CPIJ013795-PA | ortholog many-many
GO: GO:0042302:structural constituent of cuticle
KEGG: NA