ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB42968.1'
Gene ID: ZHAS_00010842
Protein ID: KFB42968.1
Description: cytochrome P450, CYP 325C4 C-term fragment
Location: KE525231.1:569363:570017:reverse strand[JBrowse]
Sequence: >ZHAS_00010842  (588 bp)    All exons in this region
ATGATCATAGCGGTAAGCTTTTTCTGAAAGGAGGATGATTAGAACTTTTGGTACTACTAAACATTATTAATTTCAATAGGGCAATGACACCACAGCGCGTCTGGTAGCACACGCTTGCCTGTTTCTGGCCATGTTTCCCGACGTTCAGGAGAAAGTCTACCAAGAGGTGCTGGAGGTGCTCCCCGCCCAAGATATCACCCCGGAAGACCTAAAGCGATTAAACTACCTGGAAAGAGTGATCATGGAAAGTCTTCGGTTAGCACCTTCCGCCCCAAACGTTGCCCGACAGACGCAAAAGGATGTGGAAATAGCCGGCTTGTTGATACCGAAAGGCACCAACATCATGATGTCTATATTTGCGATGCATCGCCGGCCGGACATTTGGGGCGCGGATGCAAATATGTTTGATCCTGATCGATTCCTACCGGAGAGGACGGCCGGACGGAACGTGCATGCTTTCATGCCATTCAGCACTGGGTCACGCAACTGCATTGGTAGCCGTTACGCGATGATGAGCATGAAGGTGATGCTGTCGTTCTTCGTGAGAAATTTTCGCCTGCAGACGAGCCTAAAGATGGACGACTTGAATTATGTGTTCGATATAACCCTCCATACGGAACGTGAGTTTCCAATTTACATGGAAAAGAGGGAATAG
Ortholog: Aedes aegypti | AAEL006044-PA | ortholog one-one
Culex quinquefasciatus | CPIJ011835-PA | ortholog one-one
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Down -1.66055143 0.0570880377 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400