ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB43089.1'
Gene ID: ZHAS_00010771
Protein ID: KFB43089.1
Description: hypothetical protein ZHAS_00010771
Location: KE525231.1:1813963:1815165:forward strand[JBrowse]
Sequence: >ZHAS_00010771  (891 bp)    All exons in this region
ATGTCCGGCGAGATGAGAAAGCTCAGTCCGGTACGCGCTTTCCATGCGTTACATCGGTGCGGCGGTGGAAGTAAAGGTATGATTTGCATGTGGAAGACGTGCGAGATGCAGATGCCGTCGTCGGGGGGGAGGTATTAAAGACACAGGCACGTCCATGCAAAGCAGATGAGCTGACCCCTCGGGTGGAAGAGATTGAATTGGAACGGTCTGTTTGTCCGGATCCGGTCGGAAGGTTGGGAGTATGGAAATTATAAAAGCATCCGACTCAGAGATCCACACGGTTAGTTGTTTATGGTCGGTTCCGGTGGATTGACGTGCGGACGGTGTGGGTTTGCTTCGTAAAGTATCGAACATGGAAGTAAGTACTTTCGAAGGTCTTCATCCATCAATTCGTTAACGAACTTTCTAACGCTGGGATAGATCTGTTCATTACTTTTCTTCAGTTTGATTGCTGCACCAACGCTTGGAGCAACCAACATCCGACGAGGGAAGTACAGACGGAACACTCCTGCATACTCGTTGCTACAGTGGGCTTTAATTGTGCTCTTCTTTGGACATCTTCTGACACCTCTGGAAGGCGCATCTTGGGTGGACAGGGCAGAATCCGGTGAGTCGGAGGAAAGTTACTACGACGGAAGCGATGCTGAGGACGACGACGAAGATCACGCCGATTCGGGAGTCTCTGAAGACACCGACGATGACTCGCACGAGCACAAAGATTCCGTTGAGATCGAATATGAAGAGAGTGACCACAATGAGCATTCGCACGCTAACGCTGTTGACGAGTCGTCCTCTTCCGAATCTGATCCAGCGGATTTCTACAGAAATAAAGAATTGTTCACCAAACATCTGAAAGGTCTTTCCCAAACGTATACCGTAGGGAAGTCGAAGCGATCCAAACAGTTGCTCCCACCGGTGACCATCTCCGTGCCGTATCCGGTGCACATCGAGCGGAAGGTGCCCGTCTTCATCGAAACGAAGGTGCCGGTGTACGTGGAGAAGAAGGTGGAGGTACCGGTGGATCGACCGTACGAGGTGCCAGTGCCGGTGAAGGTTCCGGTGTACGAAAAAGAGGTGATCCATGTGCCGCGACCCGTAGTGTACAACGTCGACCGACCGTACCCGGTGTATGTGCATAGGACAGTTTACGTGAACAAGTATCAGCCGGTCAAAGTGTTGATCAAATCACGGACTCGTTACTAG
Ortholog: Anopheles gambiae | AGAP013465-PA | ortholog many-one
GO: NA
KEGG: NA