ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB43653.1'
Gene ID: ZHAS_00011597
Protein ID: KFB43653.1
Description: AGAP001203-PA-like protein
Location: KE525262.1:933454:933954:reverse strand[JBrowse]
Sequence: >ZHAS_00011597  (501 bp)    All exons in this region
ATGCTGAAGTTTGCTGCACTCGCCACCGCCGGGCTGCTGTTCTGCGCGGTCCAGTGCGTCAAAGTGGACTACTACGGCTCGCTGTACAACCCGAAGGATGAGCTGCACGCACCGTACCGCAGCGCGAAGGAGGACAAGCAGGACTTTAGCAAAATTCCCGGCGAGCCCGGCGTGGACTACCCGATCTACCACGAGGTGCCGCACACCAGTTTCCACTGCGGCAACGTCCCGGCCATCCCCGGCATGTACGCCAACGTCGAAACCGGCTGCCAGGCCTACCACACGTGCCACGATGGGCGCGAGGGTCACCAGGGCGCCTCCTTCCTCTGCACCAACGGCACGCTGTTCAACCAGAAGGAATTCGCCTGCGACTGGTGGTACAATGTCAAGTGCGAGGAGGCTCCCAGCTACTACCACCTGAATTCCGACCCCGAGCACAACCCATTCACGCCGAAGCGCAAGCCCGAGGATGAGCACCAGAAATTCCTCATCCACGTTTAG
Ortholog: Anopheles gambiae | AGAP001203-PA | ortholog one-one
Aedes aegypti | AAEL005622-PA | ortholog one-one
Culex quinquefasciatus | CPIJ014267-PA | ortholog one-one
Drosophila melanogaster | FBpp0113017 | ortholog one-one
GO: GO:0005576:extracellular region
GO:0006030:chitin metabolic process
GO:0008061:chitin binding
KEGG: NA