ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB43822.1'
Gene ID: ZHAS_00011666
Protein ID: KFB43822.1
Description: AGAP006013-PA-like protein
Location: KE525263.1:857381:857946:reverse strand[JBrowse]
Sequence: >ZHAS_00011666  (441 bp)    All exons in this region
ATGAAGATGGTAAGTGAGCGGATAGTTGACCAAGGGGCAGGTTCCCCGGTGGCATCAGTGGTTTAGCAGCCAGTGAGTTCTTGGTGTGATAAAGCTAAAGTGACTAATCGTTATTCCTGTCTTGTGCTCCGCAGTTCGTAGCCCTGTTCGCCGTCATTGCCGTGGCCAGCGCCATCGGAGACTATCACCAGGCCCCGGCCAAGCACATCCCGATCGTGCACAGCGAGTCGTACCACGGACACGACGGTAGCTACAAGTTTGGCTACGAGTCGGCCAACGGTATCGCGGCCCAGGAGCAGGGCTTCGTGAAGAACGGTGGCAGCAAGGACCACGAGGTGCAGGTGGCGCACGGATCGTTCTCCTACACCGACCCCCATGGACACCCGGTCGCCGTCAGCTACGTCGCCGATGAGAACGGTTTCCAGGCCAAGGGAGCCCATCTGCCGACGCCGCCTCCGCTGCCGAAGGAGCTGGTCGATGCCTACGCCAAGGCCGCCAGCCAGCCCCAGCACCACGAGGAACCCCAGCACTATGCGCCCCAGCCGAGCTACAAGCACAGCTACTAA
Ortholog: Anopheles gambiae | AGAP006013-PA | ortholog one-one
Aedes aegypti | AAEL001735-PA | ortholog many-many
Aedes aegypti | AAEL001743-PA | ortholog many-many
Aedes aegypti | AAEL008866-PA | ortholog many-many
Aedes aegypti | AAEL008869-PA | ortholog many-many
Aedes aegypti | AAEL008872-PA | ortholog many-many
Aedes aegypti | AAEL008873-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016313-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016314-PA | ortholog many-many
GO: GO:0042302:structural constituent of cuticle
KEGG: NA