ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB44206.1'
Gene ID: ZHAS_00012081
Protein ID: KFB44206.1
Description: AGAP008459-PA-like protein
Location: KE525272.1:238011:238373:reverse strand[JBrowse]
Sequence: >ZHAS_00012081  (363 bp)    All exons in this region
ATGATGGTCCTCGCCGTTGCCGTCCAGGGTTCGTCCGTCTCGTACTGGGGCAATGGAGCGGCCTTGCCTTACCTGGCCCCGGCCACCCTTGGAAACTGGGTACAGGACAATTCGTACGCCCGAATTGTGTCTCCATGGAACTACGCTTACCAGGGCGTTCCGGTGGCCGCTCCCGTTGCCGCCCCAGTTGCGTACGTCGAACCCTACGCCTACCAGCCGGAGACGGTGGTCGTCCCGGCCGTAGTCCAGAAGGAGGCTCGCTATCTGGCCGCTAACCGTGGCGCTGTCCACGAGGCTCCTCTCCCGGGACACACCGTCAACCAGCAGTCGCTCAACCTGGAACCCGCACCAGGCACTCTGTAA
Ortholog: Anopheles gambiae | AGAP008459-PA | ortholog one-one
Aedes aegypti | AAEL002187-PA | ortholog one-many
Aedes aegypti | AAEL002191-PA | ortholog one-many
Aedes aegypti | AAEL002211-PA | ortholog one-many
Aedes aegypti | AAEL002223-PA | ortholog one-many
Aedes aegypti | AAEL002229-PA | ortholog one-many
Aedes aegypti | AAEL002233-PA | ortholog one-many
Aedes aegypti | AAEL002241-PA | ortholog one-many
Culex quinquefasciatus | CPIJ003486-PA | ortholog one-many
Culex quinquefasciatus | CPIJ003487-PA | ortholog one-many
Culex quinquefasciatus | CPIJ003488-PA | ortholog one-many
Culex quinquefasciatus | CPIJ003489-PA | ortholog one-many
GO: NA
KEGG: NA