ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB44207.1'
Gene ID: ZHAS_00012083
Protein ID: KFB44207.1
Description: AGAP008457-PA-like protein
Location: KE525272.1:242332:242874:reverse strand[JBrowse]
Sequence: >ZHAS_00012083  (543 bp)    All exons in this region
ATGGATCCTATCTTCCCGCCGTCCAGACTGTGCTTCCCTACTCCTACAACTCGGGACTCTAATGGCCTGAACGGTTACGATGGACTTGGCCACTACTCTGCCCTCAGTGGATTGGGATATTCTTCGGTGCTGGATGATGGATTATCGTACCCGTACTCGGCCGCTCTTCCTTACTCTGCCTACAACAACGGCCTTCTCGGATACTACGGATCAAAGTACGCTCCAACCGTCGTTCAGGCCAATGTGAACACTCTGAAGACCGTCAACCCGCTGGGTCTGTACGGAGGATATGGACTCGGTCATGCCCCAACTGTCGTCCAGGCCAACGTTGCCAGCTCTCTGAAGACGATTAACCCTCTGGGTCTGTATGGCGGATACGGTCTTGGACACGGATATGGACTGGGCCAGGCATACGGATACGGATACAACAACTACCTCCCGGTTCAGGCTCATGCTGCGAAGTATGTTGCCGCGAACCCGGGAGCTGTCCATGTCGCGCCTCTGCCAGGACATGTTGTTAACCAGAAATCGATTGTTGCTTAA
Ortholog: Anopheles gambiae | AGAP008451-PA | ortholog many-many
Anopheles gambiae | AGAP008452-PA | ortholog many-many
Anopheles gambiae | AGAP008453-PA | ortholog many-many
Anopheles gambiae | AGAP008456-PA | ortholog many-many
Anopheles gambiae | AGAP008457-PA | ortholog many-many
Anopheles gambiae | AGAP008461-PA | ortholog many-many
Anopheles gambiae | AGAP008462-PA | ortholog many-many
Anopheles gambiae | AGAP008463-PA | ortholog many-many
Anopheles gambiae | AGAP008479-PA | ortholog many-many
Anopheles gambiae | AGAP008480-PA | ortholog many-many
GO: NA
KEGG: NA