ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB44253.1'
Gene ID: ZHAS_00012148
Protein ID: KFB44253.1
Description: AGAP009875-PA-like protein
Location: KE525272.1:431947:432529:forward strand[JBrowse]
Sequence: >ZHAS_00012148  (372 bp)    All exons in this region
ATGAACAAGGTGCGTAGTGTGGTACTCAGATAAAGAAAAATCTAGAACGAATACATCAACAATCGAAGTGCAGAAAAGATCCTTTTCTGGAAGAGTGCACTTTCCCTGCTAATTGTGCGAGTTTTGTTATCTCTGCTATCGTGGTTTTAGATCGTCTGTGTGCTGGTGGTTGCGTTGATTGCGTCCGTTGCTGCGGAAAAGGATGCGGTCGTACTACGGCAGGATGTCGAAGTCAATCCGGATGGTTCATACCAGTACGCTTACGAAACCTCGAACGGCATCCAGGCTGAGGAGCAGGGCACGCTGAAGGATGTTGGTGACGACAAGGCACAGGTAAGGATTCACTCCCTAGTGCCAAAAATCACATTCGTTTTCATTCGGTTTTCTCTTCGCTTCACCAAAGGTTGTCCAGGGACAGTACGCCTACACCGATCCAGACGGTAGTCGCGTCAGCTTGCAGTACATTGCGGATGAGAACGGATTCCAGCCGCAGGGAGACCATCTGCCGACGCCCCCACCAATCCCGCCAGCAATCGAGCGCGCCCTGCGACTGTTGGCGAACCTTAGCCGGAACCAGAAGTAG
Ortholog: Anopheles gambiae | AGAP009875-PA | ortholog one-one
Aedes aegypti | AAEL003226-PA | ortholog one-one
Culex quinquefasciatus | CPIJ009326-PA | ortholog one-one
Drosophila melanogaster | FBpp0112271 | ortholog one-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA