ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB44988.1'
Gene ID: ZHAS_00012924
Protein ID: KFB44988.1
Description: cytochrome P450, CYP 4J10
Location: KE525297.1:431561:433349:reverse strand[JBrowse]
Sequence: >ZHAS_00012924  (1548 bp)    All exons in this region
ATGCTGCTCGCAATTCTAGTGTTCGTTCTGGGAAGCTGCATTACCGTACTACTGATTCGGGATTATCAGTCCAAGCGCACGGATGGATACCGGGCGGCACAGCTCTATCCAGGTGGCATGATGATCCCGGTGTTTGGAAACTTGTTGGAGTTGCTGTTTAAAAATCCCGGTATGTTCCCTTCGTATCCTTATAAGAACTCCTTTACAGTTCATCATTTTTGCAGTGCAAACATTTCGATACGCGCGTGAAAATGCCCTCCGCTACGGGGCATCCTATCGTCAGTGGATCGATGGGAAGGTGATTCTGAACATCATCCGCACGCGGGAAGCGGAAAAGATCCTGTCCAGCACGCAGCACACGCGCAAGAGCATCCTGTACAAGTTCCTCCACCCACTGATGGGCGATGGTCTGTTGTGCAGCAAAGGGACCAAGTGGCAACAGCGCAGACGAATCCTGACGCCTGCGTTCCACTTCAATATACTGCCGAAATTTTTGGTCATTTTTCAGGAGGAAAGCGAAAAGCTCGTCCACCAGCTCGGACCCTTTGCGGACGGTGCCCGAGACGTTGTCCTACAGTCGGTGGTAACCAGTTTTGCGCTGCACACAATTTGTGGTAGGTAACGGCCTGTGTGCCAATTAATTGTCTAACGGTGAATTCCATCGTAGAAACGGCAATGGGCGTTAAGCTGGACGCGTACAACGAGGCCGACGAGTATAAGAAGAAAGTGTACGAAGTCGGTGAGATGCTTGTCCACCGGACCATGTCACCGTGGTTGTACAGCGATCGGATCTACAACCTTCTCGGGTACGATGGTCCGCTGGCCGAGTCCTTGAAACCGATTCATCACTTCACCCGCAGTATCATACACCAAAGGCGCCAGGACTTCCAGGAGAACCAACAAGCTACAGATGGTGTGGCCGCAGAGGAGAATATGTATGTCTCCCCGTGGACATGAGTGGTCATGAGTTGATATAAATATTTGTACTCTTTACAGATACTTTGGTAACAAACAACGGTACGCCATGCTCGACACGCTACTGGCAGCGGAAGCGAAGCAACAAATCGATGAAGAAGGTATACGAGAGGAGGTGGACACGTTCATGTTTGAAGGGCACGATACGACGGCAGCGGCCATCATGTTCACAATCCTTTTGCTTGCCAACGAACCCGACGCGCAGGAGCATTGTTACGCCGAAGTGAAAGATTTACTAGAGCGACTTTCTCCGGAGGATGGCAAAAACATACGACCATCAGTACAGGACTACCAGGGCCTACCGTACCTCGATCGTGTTATTAAGGAATCGCTTCGGCTCTATCCACCGGTTGCATTCATTTCCCGGACAACCACCGGACAGTTGGTTGTTGGTAAGAATTATCGAATCAAACTATTCGCTCAATTTGTTTCCACTAAAGATCCATTACTCGAACCCCCTTTAGATGGTGCCAGCTTTCCCCACAACACGATCAGCCACATCCATATCTTCGATCTACACCGCGATCCGGAACAGTTTCCCGATCCCGAGCGATTCGATCCCGACCGATTCCTTCCCGAGGTGGCCGAAAAACGAAACCCCTACGCCTACGTCCCGTTCAGTGCCGGACCAAGGAATTGCATTGGACAGAAGTTTGCCATGTTGGAAATCAAAACGGTTCTAATGTGTCTGCTGCAGCATTTCCGATTTAAACCGATAACAAAGCGGGAGGAGATTGTGTTCATGGCCGATCTGGTTTTGCGTGCGAAGACGCCCCTCAAGGTGGGATTGGAACGAAGATCAGCCCAGAAATGA
Ortholog: Anopheles gambiae | AGAP006049-PA | ortholog one-one
Aedes aegypti | AAEL013555-PA | ortholog one-many
Aedes aegypti | AAEL014830-PA | ortholog one-many
Culex quinquefasciatus | CPIJ000294-PA | ortholog one-one
Drosophila melanogaster | FBpp0078701 | ortholog many-many
Drosophila melanogaster | FBpp0078703 | ortholog many-many
Drosophila melanogaster | FBpp0087672 | ortholog many-many
Drosophila melanogaster | FBpp0087673 | ortholog many-many
Drosophila melanogaster | FBpp0087674 | ortholog many-many
Drosophila melanogaster | FBpp0289683 | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: Orthology:K15001
Pathway name:
Pathway map:NA