A PHP Error was encountered

Severity: Notice

Message: Undefined offset: 1

Filename: controllers/asgdb.php

Line Number: 105

A PHP Error was encountered

Severity: Notice

Message: Undefined offset: 1

Filename: controllers/asgdb.php

Line Number: 105

search for 'KFB45546.1'
ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB45546.1'
Gene ID: ZHAS_00013494
Protein ID: KFB45546.1
Description: hypothetical protein ZHAS_00013494
Location: KE525304.1:910525:915906:reverse strand[JBrowse]
Sequence: >ZHAS_00013494  (3348 bp)    All exons in this region
ATGGCTTCTATGGGATCTTGTTAATGAAATGCTACTTTACCTTCATAACTAGGATTACCTTAGTTTTTACGTAAATTGAAAACGTGTAATAGGCTTAAATTTTTTTATGTAGGAAGTTTATCCAACATGCAAAGAAAGAGGCAAATTTAATTAAATATTTCTCTTCATACCTTCATCATATCCTTACCATCTACTTTCGATTCCAGCCTGGATATCGGCTGTGCTTCTTTTTGTGCCCATTTCACCGGTGCAAAGCGCCGATCTGGTAGAACAGGGATCTCGAAAGGCACGATCCCGAATAAGCACTCGGAGTGTGCTGCTGAACGAAGAAGCTGCTGCTGCCCTTTATGCTGTTGGTGCGAGCACCGAAGCAGATAGCTATCAAGGCTTGGTCGGACGGCCTGGCATTGATTTCCCAGTACTTACGCAGATTCCTCGCACAATTTTCGACTGCAAAAACCACGGAAATGGTTATTTCGCCGACCTAGAAACACGCTGCCAGGTGAGTTCATTGGATATGATTGGGGGGCAATGTTTCTACTGTGTGTTTTACATATCTTATTTTATTATGCACCATTTATATTGAACCATTTAGCATATGGTTTGTTAAACAGTCGAAACCAGTCACACATCCTGGAAATATTCCAAACTCAATGGTTTTTTTCCAAATATCAACAGCATGGAAACCAAAGTAAATTGTGTTTACATAAACAATTTTAAGTACACTTGAATCAAGTGGAATTAGCACACAATTTGGTGAAATAATGGTCTTCACCGACTGGTTTAAAGATATTACTACTATCTAACATCGAGTAACACACATGAATACGCCCTTTCAATAATTCTTTTGCATTATCAAGGTTATACAATTACCGAAGCTAGTAAAAAACGTATAACAATTAAATTATCAAGGTTATACGTTTATAAAATTTGAACGCTAACACCTAATGCTTTAAAATTTAAGTGAATTTTTTTATATTTATTATTATTATTATATCCAGAATTTTTTATGTCTATCTAATGAATGTTTCTTTATAGCTTAGGAATTATGATTCTAAACTATAGGACAAAACATTACAAACGTTGTATAAGGACCTATTTTAAACCCTTTCGGGTTTTTTATTGCGCGAACAATGAGAAAATGTTGTTTAAAAAAAGACAATTATCTCTAATTTTAGCTTTTTCATTTTTTTCATTAAGTTGTTTCAACGAACAAATTAATCTTAAATTTGTAAATTATAAAATTTGAAGCAGCAGTAAAAATAACAATGTTTGGAAAATTTAAATTTTACTATTTTATGTAGTTGCTTTCATGAAGTGGTCATGGGATTGGATTGTTTTATAATTTACTTTCACGAAGTGTACTATAGTTATTGAATGATCAAGACAGGAGTTACTAGCTTGTGCTTACAGGCAATACAAATTTTCCTTAAAAAAACCAGGAATCACTTCTGGCATTAATGTTTGATCCTACAATTCCTCGTTCTTAAAATGGAACAAAAAATCGGTTAGACAGACAGTTAATTTGATGATTTTATGTAATTTTGTAATTTTTACAACACGCACCGTGAACGTGAATTGTTTGTAGATGAACAAATAAGGCAGACTAAAACAACATTGCGTCTTTGAGGGTCAAGTAGAAGCATGCATAAGACACTGATCACAAAAATGTATAGACAAAACATCATGCATTTCAAATATCCATTGGAAAGGCTACACATATTGTGAGCGATCATTAATCGCTACTTTTAAATTTGCTTCCCGTTCAAGGTGTTTCACATATGTGACGAAGGCAAGAAGATCTCGTTCCTCTGCCCGAACGGTACGATTTTTCGCCAGCTCGATCTCATCTGCGACTGGTGGTTCAAAGTGGACTGCGCTGCAACGCCAAACCACTATGCCGAGAGTACTGAAATGTTGACGCAGGCTAAACGGGCCCGACTGCAGAGCAAACACCCAGTTCCGCAACCGATTAATCCCAACGACGAGCGACTGACGACCACTATCCAGGATAAGCGACTGTTGCTCGCGCAAGTTCCGAATGGGCACCGTCAGAAGCCGGCTTTTCCACTGGAACCGATTGGAAATGTGCTCGAGTTTAACCGGCGCATGGACTTGATCAACTCGGCCGAGCTTCCAGATGGAGCCGGCGAACGCAGCGAAGCTGGAAGACGCAATCGTGTTGATCGCAAGGGCGCAAGGAAAATATCATTCTCGAGCGCAGACGAGATACAGGACACCGCGCAGAGTGCTTCGTTTGCTTCGGTGGCACAGAAAATGTTCAACTCATACTATGCGCACGACAAACCGTCCAAGGACGCGACGGCCGGTAAGCTGCGTTCCGAGAACCAGGTAGAAGATGGCAGTGCGCTGCATGATCGCTCGACATTGCCCGATCCGAGAGATGCGTCCGCGAAAGGTTACAGTAACAATCACGCGGTGAACTATATACCTTACACAACGGCGCGGAAACTTAATTTGAGTGGCAAAGTGACGCAATTCTACACACCGACGGTGCCCACGTTCACCACCAGCGCCAAAACGACGGTGGTGGAATCGACCACGGCCACCGCAAAGGCCACCCTCGGGGGTGGGGATGACGATCAAGAATCGCACATTCACGCCGGTCAGCCAGTGCCGGTACGCCGTGATGGTACCATCGATGAATCCGTAATGGATCACGCAATGGAGATTATGCAAACGATCAAAAGTCTTAAAATAGATGATCCGAACAACAGTGAGAATGATGCTGACGGTTCCAGCGATGCCCTGGGTGTTCGCATTGCGGCCAGTCCTCGGGCCGATTATCAAATCAGTCCATCGTCTTCGCCGGCATCGCAGACCACATCTATACCGGTGACCGACTCCATCGAGTTCGTCCTACAGTCGGCAGGAAGTGAACCGAACGCAGATCGCTTCCGTCGAATGCGCCTGGGTGAACGCAAAGCGGACGTTCCAACTGGTCACCGATCGCTGCTAACGCGTACCACGCTGAACGAGTACGATCGATTGTTCCGCTCGAAGGATGCGGACGACGGAAACCGTCTCGACAATGGCAACCAAAACAATCTGACCGATAGCGACGCGTACTACATGGATTCGATGCTAGAGCACGACCTGGAGGGTCAGTCTTCCCGGTATCCGGTGTTTGGCATGTCTAACTCCACACAGATACGAGAGCTTGCCCAGATCTTTACTCATGCCCTGTCAGCCTACCTGCAGGACCCTGTTACCTTCCGTCGTATACTGACAGAAATTCGCCCGAAAGCTCCGGCCACAGAGAGCACAAGCTATCTGCCAACGAAATCGAACGAGCTAGACGGACAGGATCGCATTCGAGTCGGTAAGTACACTCCGGATCAAACAGCTACATTCCGTCCTTCTGCCGAGCAAGGCTACTACGCTCCTTTGAAGGCTGCGGAGAATAACAATGGTGAGGTGCTTGACTTTTCCGACGTCATAACCACTACAACGGCCCAGAATCCCACTGAGACGAGCGCAACGGAAACGACTGTTGCAATCACGTCCACGATACCCACGACTACGGTTGCCAACGAACCAGTGTTTAACACACCCAGGCCCAACAGCGGTACTAAGCAGGGCAAAAGCCTATCTATTCAGTTCATCACGGGCAGCCGCAATGAATTGGCAGATGAGGTGAACGGCGAGTTGGGATCACCGGCACTGGCGAACAATAACCATGGTTACACGGATCATGGTAGCTTTGAGGTGAAATCAAATATACCGCAAACCGTGGCAACGATAGCGCCGCTTTACAGTCAACAAACCAGCCCAAGCACGATACCTGTGAGTAGTACCACTGTTGGTACTACCAATGAACCGATTCCCTCTCCCCACTCGGAGCTCAAACCCCCAATTATGCCTGCTGCCCAGTACAACGTGGTGAGAACGCCGAAAACCACGCAACCGCTGGACGACGACGAACAGCTGCAACGCGCCCATAGTGAATCCATATTCGGCTCTCATCACCAGCGGCCCATCTACGAGCGCAACCAGTACAGCATTATACAGTTGAATAACTTAAAGTCGGGCAACAATTACGCCGGAGACACTTCTGCCACGTCCTCCACCCTAACGACGACGAACGCCAACGAGATCAAATCGGTCGAAAGTGAAAAGCAAACTTCCAACACGGGCCCTCCATCGCGAACGACAATGTCGTACACAGTTTTCTTCGACCCGCTCACGATCAACGATGAGTTAATGGAGCTGGACAAGCCGAAACCGACCGCTTCGCACGCCGCAGCGATCCATCAACCGCGCTTGTACGGATGGAATGGGACTCTTTTGAACGTCCCAGACGCGGTCACCTCGCCGGGCAGTGGGCAATCGTCGGCTCGGCTGGTGATGCGCCAACCGGAAAATCCCGCCGATATGCAGCAGAAGGCGAATGAAATGTTCGGCGACCTGAACGACGCCCAGGCGGACAAACTGATGAACGTCATGAAGATGGCTGATAAGGACAAGTCGATGCGCCGATTGATACTGCTATTGATACGCACCTGCGACGATGATCCTTCGACGGCCAACGAAGAATCCCGCAAAGCGCTACTGGATGCCCTCATCAACATTGATGGTGTGACGAGCCCTCACGGAACGAACGAGCTGTCTGGTGGTGGTTCCCAGATCCGAGACCAGGGTCAACGTCGAGGCAAAACAATCGGTACAAACGCAGCCCGAATACTGTACGATGGTCCGGTGGTACAGGGCACGCATAATTACACCGCCACAACGGAGAACTACGCTACGGTGGCAGAATCGAACGAGGATGCAGGCGGCAGCGAGGCGGTAAGTAAGGAAGACGATATTGACAGTGACGAGTTGCCCAGGGAGAGCGGTTCGCAAACCACTGTGGCCACCACACGAATGTATTCCAGCTCCGAGGCTCGTCAGAACTACCAGACGTCGAGCGGCGGTAATGAGCTCCGCGGTAGATGGGCCAAGGAATACGACGAGACACAGACGCGAGCACAAACAACGACACCACTGCCGACCACTTACTTCCAAACAACGACCAATACCGGATCTACCATCTATACCACCACTGAACCAACGACCATTCCTACCACGCCGGTCTTTACCACGAGTGGATCGGATTATGGCAGTTCTACCGTCGCAACAAGCACCGTCTCCACAACGAACCGAGCCGACGGTGGTCGATCGCTGGAGTCGTTTGAAGCGGACCCGGATTTGCAGCCACCGATCGTAGTTTCCCAGCGCCTTCCGAAGGACCTATCGAGCTCGCTGGATTATCCTGGTTCCACTGGGTCAAGCAAAAAGCATTCATCTCCTCATTATTCCGATACCCGCGCGTTGGAGTTGTTGAAATCACTCTATTCCTTGGCCGCCCGTTGGGGTTAA
Ortholog: NA |
GO: GO:0005576:extracellular region
GO:0006030:chitin metabolic process
GO:0008061:chitin binding
KEGG: NA