ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB45783.1'
Gene ID: ZHAS_00013759
Protein ID: KFB45783.1
Description: AGAP006857-PA-like protein
Location: KE525307.1:296308:296700:reverse strand[JBrowse]
Sequence: >ZHAS_00013759  (393 bp)    All exons in this region
ATGATGAAAATCACCATCGCCACCCTCGCCCTGTTGGCCGTTGCCGTGTTCGGTTATGAACACGAACACCACGATTACCATTCGCATCCGAGCTACAAGTTCGAGTATGGAGTGAAGGACCCTCACACCGGAGACCACAAGAGCCAGTGGGAGCATCGGGATGGAGATGTCGTCAAGGGAGCCTACACCCTGCACGAAGCAGATGGAACTGAGCGAGTGGTCGAGTACTCCTCGGACAAGCACAACGGTTTCCAGGCTCATGTGAAGCGAGTCGGACATGCCCACCATCCGGAAGTGTACGGACATCATGAAGGAGGACATTCGTATGGAGGACATGGTCACGGACACGCCAACAGCTATGCCAACGGTAACCTGTACAATCATCATCATTAA
Ortholog: Anopheles gambiae | AGAP006849-PA | ortholog many-many
Anopheles gambiae | AGAP006850-PA | ortholog many-many
Anopheles gambiae | AGAP006851-PA | ortholog many-many
Anopheles gambiae | AGAP006852-PA | ortholog many-many
Anopheles gambiae | AGAP006853-PA | ortholog many-many
Anopheles gambiae | AGAP006854-PA | ortholog many-many
Anopheles gambiae | AGAP006855-PA | ortholog many-many
Anopheles gambiae | AGAP006856-PA | ortholog many-many
Anopheles gambiae | AGAP006857-PA | ortholog many-many
Anopheles gambiae | AGAP006861-PA | ortholog many-many
Anopheles gambiae | AGAP006862-PA | ortholog many-many
Aedes aegypti | AAEL008969-PA | ortholog many-many
Aedes aegypti | AAEL008999-PA | ortholog many-many
Aedes aegypti | AAEL015424-PA | ortholog many-many
GO: GO:0042302:structural constituent of cuticle
KEGG: NA