ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB46763.1'
Gene ID: ZHAS_00014765
Protein ID: KFB46763.1
Description: cytochrome P450, CYP 6AF3
Location: KE525321.1:358338:360503:forward strand[JBrowse]
Sequence: >ZHAS_00014765  (1482 bp)    All exons in this region
ATGGCGTTGCACATCGGGTTGTTACTGCTCGGTAGTATATTTGCACTGCTTTACGCCTTGATCGTACAACGGTACCGTTATTGGAAGATTCGGAACATTCCTACGCTGCCTGCTTCGTTCCCTCTGGGGAACTTTGGAGCCCTGCGGCGTCTCTCACCGGCGGAAGTGTCCACCGAACTATACCGTCAGATGGATCCGAAGGAACGGTTCTACGGATTGTTCATGACACTTAAGCCCGCCATCATGATCACCGACCTCGATCTTATAAAGACGGTGCTCATCAAAGACTTCAGCTACTTTCCGGACCACGGTATCTACCACAATGAACGCGTCGATCCACTGTCCGCGCACCTGTTCTGCCTGGAGGGTGCCAAGTGGAAGAGCATCCGCTCGAAGCTATCGCCGACCTTCACGTCTGGTCGGATGAAAGCAATGTTTCCGATCCTCCATGAGGTCGCTGGTAACTTCCGCCAGTATCTGCAGACGCAGCTTACCGCGGAACCAACCGAGCTGGACCTGAAGGACTGCTGTGCCCGTATGATGATCGATAACATCGGTGGTTGCGCGTCCGGCATCGAGTGCAACAGCTTCCGCGAACCCAACAGTGCGTTCCGTCGGTCTGGTCAGCTGGTCTTTGATAGTCCACGGTACTCACAGCTGGTTACCACCGTGCTAAGGCTGTACCCCGCCATTGGACACGCACTCGGGCTGAAGATGCACCACGACGAGGTAATCGAGTTCTTCACCGAGCTCGTCAGGGATACGATAGCGATGCGCGAACGAAGCGTCATCAAGCGAGACGACCTGCTCAATACGATGATTGAGCTGAAGAGTGCGACCGAGGCTGGCCTAACAATGGATGAGTTAACGGCGCAAGCGTTTGGTTTCTTTCTGGCTGGATACGAAACGTCGTCTTCCAATATAACCTTCTGCTTGTACGAACTGGCGTTGAATGAGGAGTGTCAGGAGCGGGCGAGAGCCTGCGTTCTAGAGGCTTTGAGGAAACATGGCGGCTTGACCTACGAGGCTGTCGCAGACATGGAGTACTTGGATCGTTGCATAAACGGTAAGTCAAAGGAGACATTTTTCTTTAATTATTTTGTACATCATTGATTTGTGTAGTCTTATTATTGACCTATGATATAAGAGATATTTTGCAATTTCACCTCTACGTGAATCATGAATTGGAATAACTTTTTGTATAGATTTAGAAATTCTTAAATTTTTGCATGAGAACTTCATGAATCCCACAGGTTCGTGAATAATTCTTAACGAAGACCACTCCTTTTCGTTCAGGTCATTGAATCCATAATGGATTATAAAGAATATCTAAGATATGATAAGAAATGTTTGGAAAGATTCATAAATGTTTTGATATTCTTATGTTGAAGGATCCACCGATCAGTTAATCTTGGAGGGAAAATTTATATAACTAAATTTCCAAATTTTCCGTTTATTTTAACTGCCCTCGGTAACGGTAATAAATGTGATTTATTTTGTGTTCAACTATTTTCACGCAACCTTTTTCTTTTTATGTGGCACAATATCCCCTAGTGAGACAAGGTCTCTCTCCGAAGAGAGTTACAGTGACCAAAAGAGAGTTTATTATAGATCGGTGGTCAGACGTTCATAATACCAGAGGGTGCCATAAAAACTTTGAAACAAATAAATTATTGACAAAAAGCAAAGAAATACAACCAAACAATCGACCTGACCTACAACTAAAGATACATATTCATATCCCTTCTAGAAACCCTGCGCAAATACCCACCGCTGCCGGTTCTACACCGACTTTCCTGCAAACCCTACCGGCTTCCGGGCACCGACGTGATCCTCCCGGCTAAGACGAAGGTCCTCATACCGGTGTACGCGATCCAGCGGGACGAACGGTACTACCCCGACCCGGAACGCTTCGATCCGGACCGGTTCGCGCCGGAAGAGGTCGCCAAGCGCCACTTCAGCACGTTCCTTTCGTTCGGCGAAGGGCCACGGATCTGCATCGGTCAACGGCTGGGCGTGATGCAGTCGCGCGTCGGCCTGGCGACGCTGTTGGCCAACTTCCGCTTCCGACCCGGGCCCAGCACACCGATTCCGCTGGTGTACGCGAAGGACGCGGTAACATTGCAGAACAACGGACCCGTCCGTCTTCTCGTCGAGCCTTTATAA
Ortholog: Anopheles gambiae | AGAP011028-PA | ortholog many-many
Anopheles gambiae | AGAP011029-PA | ortholog many-many
Aedes aegypti | AAEL017539-PA | ortholog many-one
Culex quinquefasciatus | CPIJ003361-PA | ortholog many-many
Culex quinquefasciatus | CPIJ003375-PA | ortholog many-many
Culex quinquefasciatus | CPIJ003376-PA | ortholog many-many
Culex quinquefasciatus | CPIJ003377-PA | ortholog many-many
Culex quinquefasciatus | CPIJ003378-PA | ortholog many-many
Culex quinquefasciatus | CPIJ003389-PA | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: NA