ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB47087.1'
Gene ID: ZHAS_00015132
Protein ID: KFB47087.1
Description: AGAP012947-PA-like protein
Location: KE525327.1:209490:210902:reverse strand[JBrowse]
Sequence: >ZHAS_00015132  (1221 bp)    All exons in this region
ATGTTTGTGACGTCTTACGCGCCGTGCTCTTACGTCGGTTTTCGCCTCCAGGTGGTTTTCTTCGCGGTGAGCGGCGGCGTACTGGGATTGTTGCTGCTAACGGTCGGCTCCTGCCATGCGAATCCCGTGCCAGCCAAAATCCTCGGCAAGTACGTGCTGTCGTATCAACCGCCCGGACCACGGCTGGAACTGAACCCGCACGGTGATCCGGAAGCTGACGAATTGGACGAGCTTTCGAACGGGCTCGAAAGTGACGAGGGTGATGGCGAAGATTCCGATTCGCAGCCATCCGCCAACCATTATCGCTATCGGCCACACTATCAGGACTCGGTGCGGCAGCAGTACGACGAGCAGGAGCAAGATCAGGACGTGGACTATGTGGAAGATTCCGCCCCGGCTAGTGCGAACCATCAGCATAAGTACATGACGACGTATAAGACGGTGACGAGGCATGTTGGGGGACCGGGACACGGTCACTCCAGTTACTCCGATTCGGGAAGCGAGGAAGAAGAGGAGGATGGGACTAGTGCCAGTGAGGAAGCGCATGCTTACGATGCCTACCGTGCTTATGGTGGGAAAGGCAAGAAACACCAGGGTCATCATACGTCCGGCGGAGGATTAACTTCTTCGACGAGCTATGGAGGAAGTCACCAGGATCATCATCATCATTATTACCATTCGCATCATTCTCAGCAGCAACAACAGCATCAGAAGCAGCACCATCAGCAACAGCAACAGCATCGCCAGCAAGCTCAGCAGCCGCAGCAGCAGCTAAACCAGTACCATTCCCTCCACAGTTCCTACCATCCGCAGCTTATCCAGGCCTACAAGATCCTGCACGGAACTCCGAACCGACTACCGACGTCTCACGAGTACCACGATGAGGACAGCAGCGAGGAGGAAGACGAGGACTTCCGCAGTGGAGCCGCCATCGGTGCCGCCATCAGCCCGTCCGGGTACGGTGGCTACGGGTCACCACAGGTCATCCACACCAAGGGACGAGCCGTGCCCATCAGCCAGCACGTGGAAATCGAGACACCCGTACCGGTACCGTACGTCAAGAAAATCCACGTACCGATCCCGCAAGAGGTGCGCGTGAAGATCCCGCACCCCGTGCTGGTTCCCGTCCCGCGGCCCTACCCCGTCCACATACCCGTCTCACAGCCGATCGCCGTGCCCGACATCAAGGAGATAACGGTGCCGATCGAGAAGGTGGTCCCGTACCCGGTGGAGAAGAAGATTCCCGTCCCGATCGAGAAACCGGTGCCGTACCCGATCGAAAAGCACGTGCCCGTCTACCTTCCCCAGCCGATCCCGGTGAAGGTGCCGATCGTGAAAACCATCATCCACAAGGTCAAGCAGCAGACGGCCAGCGGCCCTCCGCTTCCTCCCGGAAGTGGGTCCTTCTGGTGA
Ortholog: Anopheles gambiae | AGAP012947-PA | ortholog one-one
Aedes aegypti | AAEL008748-PA | ortholog one-one
Culex quinquefasciatus | CPIJ005326-PA | ortholog one-one
Drosophila melanogaster | FBpp0083706 | ortholog one-one
GO: NA
KEGG: NA