ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB47280.1'
Gene ID: ZHAS_00015309
Protein ID: KFB47280.1
Description: hypothetical protein ZHAS_00015309
Location: KE525330.1:635356:637269:reverse strand[JBrowse]
Sequence: >ZHAS_00015309  (1659 bp)    All exons in this region
ATGGCCAATGCAAGTGTGGAAGAAAGTTCTCCAATTGTTACCCTGTCCGAGCTGGGGGCTTTACAAGGATCAACAAGTACAACTGCCTGGACGGGCCGTAAGTTGTATCAGTTCTTGGGAGTCCATTACGCACAGTCGACAGCCGGCGAAAACCGGTTTAAGGTGAGTAAGGTGTAAACGTTGAAAAAGCTTGTTGGTTTCATAGCATCACCATTATTTGCAGCCACCCAAAAAAGTTCAACCATGGCAAGGAATTAAAGACGCCACCCGTCATGGTTTGCCGTGCCCCCAGATGAAGCTGATTTCGTCGTTCCAAGGGAAAGCATTCGTGCCGGATCTTGAGGACTGCCTGACGGTGTCCATCTACAGTTCTGACGTGATTGTTATTTTTCTTTTCGTTGGGCTAGTACGGTTGTTTATAAGATATACGTTTTCATCACCAGCTTGCGGCAAGACGTCCGGTCATGTTCTTCATCCACGGTGGAGGGTTCCACGAGGGTAGCGCAAAGAATCAAACCGCCGAGTATCTGCTGGAGCGGGACGTTGTGCTGGTCGTTGCGCAGTATCGACTCGGTCCGCTGGGCTTCCTGTGTACGAAAACCGATAGCATTCCGGGCAACGTCGGTATGATGGACTTAACGCTGGCGTTGGAATGGGTGCAGGAGCACATTGAACGATTCGGAGGCGACCCGAGCAATGTCACCGTGTTTGGACAGTCGGCGGGAGCTGCCGCCATTTCGGCGCTTATGTACAGCCCAAAGGTGGCGGACTCGTTGTTCCATCGGGTGATACTGCAATCGGCCGGGTCCGCTTCTCCGTGGGTGTGGGACACGGACCCGGTTCAAAGTGCGTTCGATATTGCAATCGAGGCTGGCCTTGAAGATTCAGCTTCCTTGGAGGAAGTTGAACAATATCTTCGAAAGCTCGACGTTTGGACGCTGCTGAGGAGCTTCATCGACCTGAAGGCGGAGAAAAGCGTAGCGCAAGGGTTGGATCACGTCGGTGGCAATCGCCTCGTCGTCGGAGACTACCATGGATTTCTGCCGCAAACGCCCTGGGAGTGTATGAAGGAAGGAAAGATAAGGCAACACCTTCCAATGATGGCCGGAGTGACGAAGCACGAGGGAACTTTCCTGCTGACCACCGTGTACGATCACTTTAAGCGTACTGGGCAACTGGATGATCCGGCGTTCGTGAAGTATTTCCTTGTTGATGCGGTCAATAAGTTTCTCGGTGCGAGCGATTCTACCGGCGCTCTGGGAGGCTATGAGATGCGGACGCTCTTCTCGCAAAAGGATCTGGAGAGTGGTAGCTTCGGGGAGATGGCCGATGGATTGATCGATGTAAGCAATTTCAGCATGATTTTTAGTCATCACTTATAACTGACGTTTTTTCCAGCTGTCCGGGACGATCCTGATAAAAGCACCACTGCTTCGTGAAGCCCAGGCCAGTGCAAGAATGAACCCAACCGGCACGTTTCTTTATTCATTCGACTACGTAGGAGAGAAAACCCGGTTCGGATACGGAAACGATACTTCACACTATCCGTTCGATGGCGGTGTGCATCATTCCGACGATAAGCTGTATCTGTTCCCATATCCACCTGGAAATCCGGACGCACTGAACAAAGAGGATACCGAAATGGCTAAGTTGATGGTTGATTTGTGGACATCCTTTGCGGTGGATGGTGTACCAAAGTCGGACCGCTTGAGTGTCGAATGGAATCCTATGAAAAGTAATATTGAACGATGCCATCTCATTAACCAAATATGTCGCGATAACATTTTTTTTTACTTTTTTTACGCAGCTTATGCCGGGCCGTACTTACATATAAATGATCCACCAACCGTCGGGGAAAACTTTTATGAAGAATTTACCGTAGCAAGCGATGAAAAACGACTGCGAGCGAAATAA
Ortholog: Anopheles gambiae | AGAP010917-PA | ortholog one-one
Aedes aegypti | AAEL000918-PA | ortholog one-one
Culex quinquefasciatus | CPIJ002785-PA | ortholog one-one
GO: NA
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Down -0.66893703 0.3549482303 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Down -0.27154213 1 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400