ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB47287.1'
Gene ID: ZHAS_00015316
Protein ID: KFB47287.1
Description: AGAP010904-PA-like protein
Location: KE525330.1:730234:730924:forward strand[JBrowse]
Sequence: >ZHAS_00015316  (621 bp)    All exons in this region
ATGGCGTTCAAGGTGAGTTTCAGCATTTTTTCAAAAAAGAAAAATCTCATATAATCAATTTCATTCTCCTAATCTCTTCTAGTTTGTCCTGCTTGTGGCATCTATTGCCTGTGCCAGCGCTGGATACATCCCGAAGGATCATTCTTACAGCTCATCTTTGAGCTACTCCACCATCCATAAGAATGTTGCTCCAGTTGTGAGCAAGACGATCATTCAGGAACCTCAGCTGTACCACGGTTACGCTCAGGGCGCTCCGTCTGTTGTGGTCAGCAAGCCTCTTGCGCTTACGGAAGCTCTACCAGTGTCCTACAGTGCTCCGCAGTCCATCTATCAGGCTCCAGCATACGTGAAGAACTTCGAATACGCCCCGAAGCCGCTGTCATATGTTCCAATTGGCAAGACCATCATTGGTGAGCCGTCTTATGGCAAGACCATCATTGCTGAGCCGTCTTATGGCAAGACCATCATTGCTGAGCCGGCTTACGCCAAGACCATCATTTCTGAGCCAGTGTACGGCAAGACCATCGTGTCTGAGCCAATCTACACCAAGAACGTGTACGCCGAGCCAATCTATCAGTCGAAATCCTTGATCGCTGAGCCAGTGTACGGCAAGAGCATCCTGGCTCAGTCAGCTCCGATCTATGGTGGAAAGGTCCTTTCCTCGGGAGGCATCGCTGCTCACGGATGGTAG
Ortholog: Anopheles gambiae | AGAP010903-PA | ortholog many-many
Anopheles gambiae | AGAP010904-PA | ortholog many-many
Anopheles gambiae | AGAP010905-PA | ortholog many-many
Anopheles gambiae | AGAP010906-PA | ortholog many-many
Anopheles gambiae | AGAP010907-PA | ortholog many-many
Anopheles gambiae | AGAP010908-PA | ortholog many-many
Aedes aegypti | AAEL000878-PA | ortholog many-many
Aedes aegypti | AAEL000879-PA | ortholog many-many
Aedes aegypti | AAEL000909-PA | ortholog many-many
Aedes aegypti | AAEL000914-PA | ortholog many-many
GO: NA
KEGG: NA