ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB47290.1'
Gene ID: ZHAS_00015320
Protein ID: KFB47290.1
Description: AGAP010902-PA-like protein
Location: KE525330.1:750595:751451:forward strand[JBrowse]
Sequence: >ZHAS_00015320  (708 bp)    All exons in this region
ATGGCTTTTAAGGTAAGAGTTCCAAGCAGCAAGCAACAAATAGCAATAAGTGATCAATCGTGTACTCGGTGATGGACTATTTTGTTATGAGTGTAAAGTGCCCAAGAGTTCAACCAATGTGTCCTAATGTGTTGTTCTAATTTGTGTCGTGTTTCCTCCAGATTGTTGTTCTGTTCGCCACCCTGGCCTGCGCCAGCGCCGGATACGTCCAACCGGCACATGAGCATCTGTCCTACGAAGCCGCACCGGTGGCTCACTACTCGTCTGCTCCGGCCGTGAGCTACAGCTCCTTCACCCGTCAGGACTCGCCGAAGCTGGCCGTTGCCAAGACGCTGTCCTACGCCGAGCCGTCGGTGCACTACGCTGCTCCCCTCACCAAGACCTACGCCGTCCATGAGCCCGCCCTGAAGACGGTTGTTGCCCAGCCGGCCTACACCAAGACCGTCTACACCCAGGAGCCAGCCCATGTCTACGCTCATGCCGCCCCAGTCGTCGCTGCCAAGACCGTGTCCTACGCCGCCCCGCAGGTGCACTACCAGGCTCCGCTGCTGAAGAACGTTGAGTACACCAAGACCCTGGCGTACGCTCAGCCGACTTACACCAAGCACGTCGTTGCCGAGCCGGCATACACCAAGACCGCATACGTCTCGCAGCCGACCTACACCAAGACCGCGTACGTCCAGCAGCCGACTTACACCAAGACCCTCGTCGCTGAGCACCAGCCTCTGTACCACCAAAGCACCCCGGTGTACGCCCATGCCGCTCCCGTCGTCGCCGCCAAGACTCTGAGCTACGAGCCAGCCGGCCATGTGTCGCACGTCAGCTACGCCGACAACAGCGCTCACTACGCCTGGTAA
Ortholog: Anopheles gambiae | AGAP010902-PA | ortholog one-one
Culex quinquefasciatus | CPIJ002796-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002797-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002798-PA | ortholog one-many
GO: NA
KEGG: NA