ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB47292.1'
Gene ID: ZHAS_00015322
Protein ID: KFB47292.1
Description: AGAP010901-PA-like protein
Location: KE525330.1:761579:762454:forward strand[JBrowse]
Sequence: >ZHAS_00015322  (876 bp)    All exons in this region
ATGTTTTATTTGTTATCTTTCGTTACTCTCCCGTGGATACAGTTCGTCGTCTTCCTGGCCTCGTTGGCCGTCGCTAGCGCTGGATATCTGGAGGCTGGCCATGCCGTCCAGTACGCCGCCCCGGTGGCTCACTACTCGCCGGCTTCGGCGGTGAGCTACAGCACCATCTCGCAGGCTGCCCCGGCCAAGCTGGCCTACGCCGCCCCGGTCGCCAAGACCGTCTCGTACGCCGCCCCTCAGGTCTACGCCGCCCCTCAGGTGTACGCCGCCCCGCAGGTCTATGCTGCCCCGGTTGCCAAGACTGTCTACTCCAGCCCGGCCGTCGGTGCCACGCACGAGAGCACGATCCGTTCCCATGATGGAACCGTCTCGCACTACTCCAAGGCCGTCGACACCGCTTTCTCGAGCGTCCGCAAGTCTGACACCCGCATCACCAACGAGCTGCCCAAGTACACCTATGCCCAGCCCGTCCTGGCCAAGCAGGTCGCCTATGCTGCTCCGGCTGTCCACGCCACCTATGCCGCTCCGGCCGTCCACACCAGCTATGCTGCTCCGGCTGTCCACACCAGCTATGCTGCCCCGGCTGTCCACACCACCTATGCCGCTCCGGCCGTCCACACCAGCTATGCTGCCCCGGCTGTTGCCACCTATGCTCATGCTGCCCCGGCTGTCCACACCACCTATGCCGCTCCGGCTGTTCAGCATAGCTATGCTGCCCCGGCTGTTGCCACCTACGCCCATGCTGCCCCGGCCGTTGCCACCTACGCGCATGCTGCCCCGGCTGTCCACACCTCCACCAAGACTCTGACCTACTCGCCGGCCGTCCAGGTTGCGCATACCACCTACGAAGACGCCCATGCCCATTATGCCTGGTAA
Ortholog: Anopheles gambiae | AGAP010900-PA | ortholog many-many
Anopheles gambiae | AGAP010901-PA | ortholog many-many
Aedes aegypti | AAEL000890-PA | ortholog many-many
Aedes aegypti | AAEL000896-PA | ortholog many-many
Culex quinquefasciatus | CPIJ002799-PA | ortholog many-many
Culex quinquefasciatus | CPIJ002800-PA | ortholog many-many
Culex quinquefasciatus | CPIJ002801-PA | ortholog many-many
Culex quinquefasciatus | CPIJ002802-PA | ortholog many-many
Drosophila melanogaster | FBpp0076541 | ortholog many-many
Drosophila melanogaster | FBpp0076572 | ortholog many-many
Drosophila melanogaster | FBpp0076573 | ortholog many-many
GO: NA
KEGG: NA