ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB47536.1'
Gene ID: ZHAS_00015497
Protein ID: KFB47536.1
Description: hypothetical protein ZHAS_00015497
Location: KE525331.1:2623242:2623850:forward strand[JBrowse]
Sequence: >ZHAS_00015497  (609 bp)    All exons in this region
ATGGTGAATTCTAAAGTGCGTGCCATTGCTCTGTTGGTGCTCGTGGTGGCCACAGTCGTCCACGGCGCTCCACAGAAAAAGGCCCCCTTCGGTAAGGGACGAGGTGGAGCTGGATCGGAAGCGCAAAAACCAGAACCACCGGCGGAAGATGAGCCCAAGGGTTCGTCGTCTGCGGAAAGTGAAGAAGAGTCGCTGGAGAAAACGCAAGCCAAAGCAGCAAAGTATTCGTACGACACGTCCGTGAACGACACCATCAATGATCACGCGATCATGCGCCAGGAGGAACGGGACGGTCTGTCGCTGAAGGGAATGTACTCGTACAGCGATGGGTTCTTCAGGCGCACCGTGCACTACGAGGCGGACGACAAGGGCTACCGGGTGGTGAAGGAGATTAACATCCCGATCGGTAACGGGCCACAGGTCGATCCGAACGGTAAGGCCGACGTTTCGTCCTCGCTGACCGGATCGTACTCCATTACGGCGGACGACATCGCGAAACCGTCCCGGAAGGAAGTGGCGCGGTCATCGTCGGGGGAGGACGAATCTCCGGAGGACACTCGCGCCGACGATGACGATGAGGAGCAGGAAAATGGTTCGGAAGAAAATTAG
Ortholog: Aedes aegypti | AAEL011642-PA | ortholog one-one
Culex quinquefasciatus | CPIJ006215-PA | ortholog one-many
Culex quinquefasciatus | CPIJ019875-PA | ortholog one-many
Drosophila melanogaster | FBpp0086643 | ortholog one-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA