ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB47662.1'
Gene ID: ZHAS_00015706
Protein ID: KFB47662.1
Description: AGAP001668-PA-like protein
Location: KE525332.1:432558:433432:forward strand[JBrowse]
Sequence: >ZHAS_00015706  (780 bp)    All exons in this region
ATGGCATTCAAGGTAGGTGGTGTCTCGCTTGCCCGGAAGTCAAGTGGGTCTCCGGAAGAGGCTGGCGTGAAAACTGATTTTATTTCTTATCGATTTGGTTTCACCAGTTTGTGACCTTCGCCGCTCTGGTCGCCGTCGCTCGCGCCGGACTGATTGCCCAGCCCGCGCTGAGCTACGCCGCCGCCCCGGCCGTCCTCTCGGCCCCGGTTGCCAAGGTCGCCTATGCGTCGGCTCCGATCGCCAAGGTCGCTTACGCCGCCCAGCCCGAGGAGTACGACGCGAACCCGCAGTACTCGTTCTCGTACGGAATCTCCGACGCTCTGACCGGAGACTCCAAGTCCCAGCAGGAGTCGCGCAGCGGAGATGTTGTCCAGGGATCGTACTCCGTCGTTGATCCCGATGGCACCAAGCGTACTGTGGACTACACTGCTGACTCGTACAACGGATTCAACGCCGTGGTCCGCCGTGAACCCCTAGCCAAGGCTGTTGTTGCCGCTCCGGTCGCCACCAAGGTCATCGCTCAGCCAGCTCTGGCCTATGCTGCCCCAGTTGCCAAGACCATCTCCTATGCCGCTCCGGTAGCCAAGACCATCTCGTACTCTGCCCCGGTGGCCACCAAGACCATCGTGTCGAGCCAGCCTGCCCTGTCCTACGCTGCCCCGGCTTACGCCACCCAGGCTTACGCCGCTCCTCTGGCTAAGACCTACATCTCGAGCCAGCCTGCTCTCTCCTACGCTGCTCCGGCGTACGCCACCCAGGCCTATGCCGCCCCGGCTTACGCCACCCAGGCCTATGCCGCTCCTCTGGCTAAGACCTACATCTCGAGCCAGCCCGCTCTCTCCTACTCCGCCCCGGCTTACGCCTCGTACCACTAA
Ortholog: Anopheles gambiae | AGAP001664-PA | ortholog many-many
Anopheles gambiae | AGAP001665-PA | ortholog many-many
Anopheles gambiae | AGAP001666-PA | ortholog many-many
Anopheles gambiae | AGAP001667-PA | ortholog many-many
Anopheles gambiae | AGAP001668-PA | ortholog many-many
Anopheles gambiae | AGAP001669-PA | ortholog many-many
Aedes aegypti | AAEL009783-PA | ortholog many-many
Aedes aegypti | AAEL009784-PA | ortholog many-many
Aedes aegypti | AAEL009788-PA | ortholog many-many
Aedes aegypti | AAEL009790-PA | ortholog many-many
Aedes aegypti | AAEL009791-PA | ortholog many-many
Aedes aegypti | AAEL009793-PA | ortholog many-many
Aedes aegypti | AAEL009794-PA | ortholog many-many
Aedes aegypti | AAEL009796-PA | ortholog many-many
Aedes aegypti | AAEL009800-PA | ortholog many-many
Aedes aegypti | AAEL009801-PA | ortholog many-many
Aedes aegypti | AAEL009802-PA | ortholog many-many
Aedes aegypti | AAEL009803-PA | ortholog many-many
Aedes aegypti | AAEL009807-PA | ortholog many-many
Aedes aegypti | AAEL015163-PA | ortholog many-many
Aedes aegypti | AAEL015363-PA | ortholog many-many
Aedes aegypti | AAEL015364-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001830-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001831-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001832-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001833-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001834-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001835-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001836-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001837-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001838-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001839-PA | ortholog many-many
Culex quinquefasciatus | CPIJ001840-PA | ortholog many-many
Drosophila melanogaster | FBpp0083221 | ortholog many-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA