ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB48523.1'
Gene ID: ZHAS_00016832
Protein ID: KFB48523.1
Description: AGAP005836-PA-like protein
Location: KE525341.1:307565:314696:reverse strand[JBrowse]
Sequence: >ZHAS_00016832  (1713 bp)    All exons in this region
ATGAGTTCTACACAGCTACGTCCTATACCAGTGATTCGAGTGTACGTTGGAGTGCTGTTGATACTGTACTGCTTTGAAGACGCAGAAACACATCCAAAATGGCCTCGCGTGTGCATTAAAGATGGATGTTTAAGGGGTACTTGGCTGAAAGATAGTGTTGAAAGTCCCTATCCTGCGTTCCTGGGTATTCCGTTTGCGAAACCACCGATCGGTAATCTTCGTTTCAAGGTATATTAAAGTAGAAGATATTATACAAATTTTTTTTGACGATTCGTAAAACCTTATAACATCGTTATTTCCCTACTTATAGAATCCTCAACCGGCTGATTCCTGGGAAGGTGTATACGATGCAACATCAGATAAAGATGCCTGTATTCAAAAAGATTCAGTGGTTCCAGGTGCTCCAATCTTGGGCGTAGAAGATTGCCTGTATCTTAACGTGTTCACACCGCCGAATGCGTACTTCTCTGCATCGCGACCTCTCCCAGTCATGGTATTCATTCACGGTGGAGCCTTTTCTTTTGGATCGGCCCGACTAGCCGAACTTGATCCATCCAGAATCATAACAACAAGGAAGATAGTGGTCGTAACGCTACAGTATCGAGTCGGAGTATTTGGATTTTTCTCTACGGGCGATCGATCGGCGTCAGGAAACTACGGTCTGAAGGATCAAGTCATGGCCCTTCGGTGGGTCCAGAGTAACATCCGTGCTTTCGGAGGTGATCCCCGACGAGTGACGCTTGTCGGCCAAAGTGCCGGTGGTGCCTGCACACAGTTACACATGTTGAGTCCGCTGAGTCGTGGTCTATTCCATCGAGCCATATCGATGAGTGGAAGTGCCCTTGCCAAATGGAGCACTCCGTTTTCCGATCCACTGGCTATGGCTAGGACCCACGGACATGCTCTGGGCATCAAAGATGCAGACACTATCTCCACAATGGAACTTGTAGAAAGCTTTCGGACGATTGACGCAGTCATTTTGACTAACAGTATTGATCTTTTGAAGGTTTGGAATGTTCACCTTATCGCCCCATATCGTCCAGTTGTAGAATCTCAAGATGAGCCGGATGTGTTTCTGAACGAAGCCCCAAAGACAGCCTGGAGTCGTGGGAAGTACGCGAGCGTTCCTTGGATGACGGGGTCCATACCAACTGGTTCTTCAATTCTCACCCAAACAATCTATCAAAACAAGTCGTTAGTCGCTAATCTAAACCTCAAGTTCGGTGAAGTTCTGGAACTTCTTCTACAAACAGATTTATCGTCCAAAGAGTTGATTCAGTTAAGGCAGCGTTTTCTCAAGACCACCCCTCCCAACAAGTGGATGACCGAAAAAAACTACGTTGAAGTTACAAAAGTAAGTAGATTAATTGCTGAGTAAACTAGCAAACAGGTGACTATAAAACACTTTCATTTCTCAGATGCTCTCGGAAGCCGAGTTTCTTTATCCAATGATCAAAAGCGTGAAGCAACACCTTCAGAACAGAAAACAAGCTGAATCAACTAGCGTATACTCCTTCGAATTCCAAGGACGATACTCCTTCTCACAAGTCTTCACCGGCACAAACAAGTCCTATGGGTTGACCCATCCGGACGAGCTGCTATACCTATTCAGATTTCCAGCGTTCTTCCCAGAGTTCCCTCCCGGTTCACCTGAAGCAGAAATGTGTCAGCTGTGGGTGAAATTTCTCATCAATTTTGTGACAAAAACGAACGTTGAAAATGAAGGAACTTGCACCGCGCTGCAATGTAATGTGGTGACGTTCGGAAACACTAACAACGTTTATTTTCCCGTCAACACAACGCTCGTACTTGGATTAGATGAAGAGGCGTACCGGTTTTGGGAAAATTTCTATCGAAAATAAATCAAAAAGATTACCAGAAATACTTAAAATTCCGTGGGTATTTCCGCCTTATTGTGAATATAGTAAGTATATTTTGCATTATTTTCCAAGGTATCACCGTGTTACTCTTGCAAACCATGTATAGATTATGTTTCGCCACCTTCCCTGCTATCCACAAGCTCTGCTGTGAAGAAAATAAAAGTGGGAAAGATTGCAATTTAATTGAGTTCACTCCGCAAAGATGAAATCTCAGCAAATGATGCAAAACCAGTTTCCTTTTCATGTTTCTTAGAAACAATCTGCGAATTTTATAATTTCACTAAAACCTGTCGAGGCAAAAAACCAGTCGAATAAGTGTTTTTTTTTATTTAAAACTTGTTCAGAACGAAGGAAATGGAGAAAGCAAGAATTGCCAGAAATAGGTCAATGTGAAAGTAACTCCCCTTCCGGTATAAAAAGAATGCAGTTCCGTCAACAAAGCTTCAGTGCTTTTTACCCTCTGTTGGGAAGTGGAGTTAACCTATGGTGGAAATTCAATAAGTTTGTGGTAATTTGTTGTCATGTGAAGTGTTAAGCTATAAAATGATTTCCGCACAGCCAAGCCTTGTATCGGTAATGCGAGTATACGTTGGAATGCTGTTGATATTGTACTGCTTTGGAGAAACAGAAACACATCCTAACTTACCTTACGTGTGCATTAAAGATGGATGTTTAAGAGGTGCTTGGCTAAAAGATAGCGTTGACAGACCCTATCCCGCGTTTCTGGGTATTCCTTTTGCTAAACCACCGGTCGGTAATCTTCGCTTCAAGGTATGTGAAAGAAAAAGATACCAACGATTGTTTGACAATTCATAACACGGTATTATACCGATATTTCGCAACATTTAGAATCCTCAACCGGCTGATTCCTGGGAAGGTGTATACAATGCAACAACAGATAAAGATGCCTGTATTCAGAAAATTTCAGTGCTCCCAGGTGCTCCAATGTTTGGCGTAGAAGATTGTCTGTATTTGAATGTGTTCACACCGCCAAATTCGTACTCTCCTGCATCTCGACCTCTCCCAGTCATGGTGTACATACACGGCGGTGCCTTTTTCTTTGGATCGGCCCGGCCAGCCGAATTAAGTCCAGCCAGAATTATGACAACAAGGAAGGTAGTGGTCGTAACGCTACAGTATCGTCTCGGGGTGTTTGGTTTTTTCTCCACAGGAGATCGTTCGGCGTCAGGAAACTACGGTCTGAAGGATCAAGTCATGGCCCTTCGGTGGGTCCAAAGTAACATCCGTGCTTTCGGAGGAGATCCAAAACGAGTTACCATCTTCGGCCAAAGTGCCGGTGGTGCCTGCACACAGTTCCACATGTTGAGTCCGCTGAGTTGTGGTCTGTTCCATCGAGCCATATCGATGAGTGGAAGTGCACTTGCCAAATGGAGCGCTCCGATTCTCGATCCGTTGGCTGTAGCAAGGACCCACGGTCGTATTTTGAAAATCCAGAATGCGGAATCTATGCCCACAATAGAACTAGTTGAAAAATTTCGAGGGATTGACGCAGTCATTTTGACTAACAGTATTGATCTCTTGAAGGTGTGGGATATTCACCCTATCTCCCCATATCGTCCGGTTGTAGAATCTCAAGATGAACCGGATGCGTTCCTCACCGAAGCTCCCAAGACAGCCTGGAGTCGTGGGAAGTACGCGAGCGTTCCTTGGATGACGGGGTCCATACCAACCGATGCCTCATTTCTAACGCAAACGATATATAGGAACGAATCATTGATCGCGGACCTGAACCCCAGGTTTATTCAAATTCTTAAACTTCTTCTGCAAACGGACATATCATTCAAAGAGATTAAAAGCTTAAGGAAGCGGTACCTAACGACCACTCCTCCTGACAAGTGGATCACGACAACAAATTACGCCGAAGTCACTACAGTAAGTATCTACTTACAATCTCCATAAAACTCACGAACAACAGATTAAAAAAAATTGAATTTTCCAGATGCTCTCGGAAGCTGAGTTTCTCTACCCAATGATCAAAAGTGTCAGGGAGCACATTAAAAACCGAGAGCAAGCAGAATCGACTAGCGTATACTCTTTCCAATTTGAAGGACGATACTCCTACTCCCAAGTCTTTACCGGTACTAACAAGTCGTACGGACTCACCCATCCAGATGAGCTGATTTACCTTTTCAGAATTCCTGTATTCTTCCCCGAGTTTCCTGCCGGTTCACCTGAAGCAGAAATGTCTCAGTTGTGGGTGAAATTTCTGGTGGATTTTGCGACGAAAACGAACATTAAAAGCGAAGGAACCTGTAACGCGCTCAAATGTAATGTGGTGACGTTCGGAAACACTAACAACGTTTATTTCCCAGTCAATAAAACGATCACACCTGGGATGGATGAGGAATTATACCGGTTTTGGAAAAAATTTTATGGAGAGTAAAATGAAACGACATCAATAAAATTAAAAAATAAGCAAAATATTCGAAACGAGAAAGAGTGAGTACATATGTATCTCGATCTACAAGAAGTATAACAAAATCTATTTTTGCTGTGCTTATCACAAGGAGAAAACAGCAGCACAAATTTTGACCAAAACTATTAAAAGCATGGAAAACAACGTAGAATTACTTTTTCCATACCCAAAAACTTCGCGTTGTGTACAATACAATATCAGCCGTAAAATGTGGACCAGATATTTTGGGAAGAAAAGAAATACCCCAAGGGTAAGCAATCCCAAAACCGGTGTTACGGTTTGTTTTGTTTCTAGCGGGTGCTTTAATACATAATAGAGCTCTAACCACCCCTATTCTCCCGGTTACAGAATGGTGGATTATCTAATCGATGCTTGAACATCATTGCTTGATGTAAAACCTTATAGCATGACAATTAAAATAAACATCTTAATAGGTTAACTTCAGAAAAAATACCAGGAGAAAGTGAATTCGTGTTGAAACAGGTTTAAAATTTCGGCGCACAGTAGGGATGCCCGAAACAAATTGGTGGACAGACTAGTTTTTGTAGACTAATGATTACAATCGATTTTTGTTGTGATAGAGAATTACGTACAAAACTTTTTTTTTCTATTCGCCATACAACATCATTCAAAATGTTTCATTGTATAGTATGTATAAATACATTATATCTTATTTGATGTATAAACATTAGTACTAAAGCTGTGATTTAAAACTGACGACGATCACCTATTGTGCAGCCTCACACCTACATTTGGGCGGAGAAAGCATTAGTGAGAACTCGATATGTTAATCAAAGGTGAAAGTTCCAATACTTGGGGTATAAAAATGAAGCATCGCTCGGGATTACGTTTTAGTTTTACGTATCCATTGCTGGGGAATGGTGCTTTCAGAGGACAGAAAAAAGTAAATACTAAAATAGTTCGTAAAAGTGTTAAAAATTGCAAAGATAACATGAGTGTGGCTCCATCAGTGTTACAACTATACGCTGCAGTGCTTTTAGTATTCTTCTGCCTAACAGTCACGAACTCGTTTCCAAAAGGACCTCTAGTGTGCATTAAAAAAGATAGATGCTTACGAGGTGTGGTGCTAAGAGACAGTGTCGATGGCCCGTACAGCGCGTACTTAGGAATTCCTTTCGCGAAACCACCAGTCGGTAATCTCAGGTTCAAGGTAAGGAAAATAGAACAAAGGGGAACATGTTGACCCAACTTTTAATTTAGATAACGATAAACTAAACAAAGTCAACGTTTCATTTTAAAATCATGCAGAATCCTCAACCGGCGGATTCCTGGGAAGGTGTATACGATGCATCGAAAGACAAAAAAGCATGCATTCAGAAAAGTACCATCCCGAATTCACCAGTCAATGGCGCGGAAGATTGTCTGTATCTCAACGTATTTACACCCCAGAATGCTTACTCGCCGTACAGTGGACTCTTGCCCGTCATGGTGTACATTCACGGTGGTTCCTATATAGTTGGATCGGCCCGATTAAGTGAACTAGATCCGGCGAGAATTATGACACAACGAAAGGTAGTGGTCGTAACGCTACAGTATCGCCTCGGAGTGTTAGGATTTTTCTCTACGGGCGATCGATCGGCGTCAGGAAACTACGGTCTGAAGGATCAAGTTATGGCCCTTCGTTGGGTTCAAAATAACATCCGTGCTTTTGGAGGTGATCCTCGACGTGTGACTATCTTCGGTCAGAGTGCCGGCAGTGCCTGCACCCAGTTCCATATGTTGAGTCCGCTGAGTCGTGGACTATTCCATCGAGCCATATCGATGAGTGGAAGTGCTCTTGCCAAATTCAGCGCTCCGGTTCCCAATCCACAGGCTGTAGCAAGAGCCCATGGTCGTATTTTAGGAATCCCAGATGCAGCGACTATTTCCACATCGGAGCTTGTTCAAAGGCTTCGGACATTCAATGCGAGCGTATTATTGACTAGTGCCGATGGTTTGAAATTTTGGGACTATCAATCTAATGTCCCCTATCGTCCGGCTGTGGAACCGCAAGATGAACCGGATGCGTTCCTGACTGAAGCTCCCAATACTGCCTGGCGTCGTGGGAAATACACAAGCGTTCCTTGGTTGACCGGAACTATACCGACGGATGCCTCGTTTCAAACGCAAGCAGTCTACCAGAACAAGTCGCTGATCGCGCAAGTAGACCCCCTGTTTCCGCAACTGTTTCAACTTTCTCTTCAAACTGAAGTATCGAACATGGGGTTTGCAAGCTTAAGGCGGCGTTTCCTCAAGACCACTCCGCCCAACAAGTGGCTTACGGAAACGAACTACGCCGAAATCACTAAAGTAAGTAGAGCTACCAGAAGTCGCGCGGTGAACTGTTGTGATTAATTTATTTTTAATTTCTCAGATGCTCTCGGAAGCCGATTTCATCTATCCAATGGTCAAAGGCGTGAAGCAGTATCTTCAGAACCAAAACCACGCCCCGACGAGTGTGTACTCCTTCCAGTTCAACGGGCGATACTCCTACTCACAAGTCTACACGAGGACCAACACGTCCTACGGACTCACCCATCCGGATGAACTGATCTACCTATTCAGAATTCCTGTATTCTTCCCAGAGTTCCCTCCCGGTTCACCTGAAGCAGAAATGTGTCAGATATGGGTGAAATTTCTTGTAGATTTTGCAACTAAATCTAACGTTGCAAAGGAAGCGACCTGCGCTGGGATGAACTGCAACGTTGTGACTTTTACAAATTCCAACAACACTTATTTCCCGGTAAGAAAGATCCTGGTGCCCGGATTGGATGAAGACATGTACGAGTTCTGGAAGGCACTTTTTGCGGAATGA
Ortholog: Anopheles gambiae | AGAP005835-PA | ortholog one-many
Anopheles gambiae | AGAP005836-PA | ortholog one-many
Aedes aegypti | AAEL005182-PA | ortholog one-many
Aedes aegypti | AAEL005198-PA | ortholog one-many
Aedes aegypti | AAEL005199-PA | ortholog one-many
Aedes aegypti | AAEL005210-PA | ortholog one-many
Aedes aegypti | AAEL015590-PA | ortholog one-many
Aedes aegypti | AAEL015602-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002074-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002075-PA | ortholog one-many
Culex quinquefasciatus | CPIJ004066-PA | ortholog one-many
Culex quinquefasciatus | CPIJ013026-PA | ortholog one-many
Culex quinquefasciatus | CPIJ013027-PA | ortholog one-many
Culex quinquefasciatus | CPIJ013028-PA | ortholog one-many
Culex quinquefasciatus | CPIJ013029-PA | ortholog one-many
Culex quinquefasciatus | CPIJ013175-PA | ortholog one-many
GO: NA
KEGG: NA