ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB48691.1'
Gene ID: ZHAS_00016691
Protein ID: KFB48691.1
Description: hypothetical protein ZHAS_00016691
Location: KE525341.1:2026921:2027649:reverse strand[JBrowse]
Sequence: >ZHAS_00016691  (615 bp)    All exons in this region
ATGTTCCGATTGGTAAATATCGAACGAGGATCTCGCACTTTGGAAGTGCTTCGCCAGAGGGCGCTATTCACGTGTGTGTGTGGTTAGGTGTGAAAATTAAAAACGTGTTAATTTTTCCCTGTTCAGGTGGTGTTGTCCGTTGTTCTCGCTGTTGCCGCTGCTGCCCCGTCGGCGACGCACGTTGTCCACGCCAGCCCTCTGGCCTACTCGACCGTCGTGGCGGCCCCGACTCTGGTGGCCCAGAAGGAGATCTCCTACCAGAAGAGCATCGTGGAGGAACCGACCGTGGCGCACGTTGGAACCGTTCTCAAGAACGTCCCGACCGGTGTGACCCACACCAGCTCGGCCGTTGTTCACGATACTAAGGTGCGGGAGGATGTGTACGCCCCGACCGTGAAGAAGACCGTCGTGACGACTCCGGTGGAGAAGACGACCTACGTCCAGGCCGCCACTCCGGTCGTGTACGCCGCCCCGAAGACGACCTATGTTGAGGCCGCCGCCCCGGTTGTCTATGCTGCCCCGAAGGCCACCTATGTTGAGGCCGCCTCCCCGATCGTGTACGCCGCCCCGAAGGCCACCTACGTCCAGGCTGTCGCCCCGAAGGCCGCCTACACCTACGCCGAGGCCCCGGTTCTGTCCTATGCCGCTCCTCTGGCCAAGACTGCCTACGTCAACAGCTACCCGTCGGTGTACGCCGCCCCGGCCGTCTACGCCAGCCAGTACCACTAA
Ortholog: Anopheles gambiae | AGAP006146-PA | ortholog one-one
Aedes aegypti | AAEL001683-PA | ortholog one-one
Culex quinquefasciatus | CPIJ009099-PA | ortholog one-one
Drosophila melanogaster | FBpp0075125 | ortholog many-many
Drosophila melanogaster | FBpp0075129 | ortholog many-many
Drosophila melanogaster | FBpp0075190 | ortholog many-many
Drosophila melanogaster | FBpp0075191 | ortholog many-many
Drosophila melanogaster | FBpp0075192 | ortholog many-many
Drosophila melanogaster | FBpp0075225 | ortholog many-many
GO: NA
KEGG: NA