ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB48754.1'
Gene ID: ZHAS_00016760
Protein ID: KFB48754.1
Description: Carboxyl/Cholin esterases, E
Location: KE525341.1:2388676:2401225:forward strand[JBrowse]
Sequence: >ZHAS_00016760  (4971 bp)    All exons in this region
ATGAAGTCGCCAGAGAGGAAGTGCGTCCGGTTTCTTTTGCTCATTAGCTGCATCGCGTTGGAAGCGTTGGCAAAGACTGACCACCCCGTGGTTACCATCTCCAATGGTCCAATCGTTGGCGAGCGGCGTGGTAATTATTACGCCTTCGAGGGACTGCCGTACGCAAAGGCTCCGATCGGGGAGCGCCGTTTTGCGTCACCGGAATTGAACGACGATGTGTGGGAAGAACCACGGAATGCCACCACCTTGGGGGCGTACTGTATGCAGTGGAGCCACACGATTCCCGGTGAGGATAAACTGTTCGGGGAAGAAGACTGTCTGTACGTCAATGTGTACACAACGGCGCTGGAGCTACCGGAAAAGCCGGCGGACACTCGGTCGACCCTGGTGTACATCCATGGCGGTGCGTTCATGTTCGGTGGTGGAGGATTATTTTCACCCAAACACATCCTGCAGAAGCCAATGATTGTGGTCACGTTCAACTATCGGCTCGGTCCGCTCGGGTTCCTCAGCACCGAGGACGACGTGATTCCCGGGAACTTTGGCCTGAAAGATCAAGTGACGGCCCTGCAGTGGGTTAAGAAAAACATCCACCACTTCGGTGGCGACCCCGAGCGGGTCACTTTGGTTGGCTTCTCGGCCGGCGGTGCTAGCGTCCATCTGCACTACTTCTCGCCGATGTCACGCGGATTGTTCCAGAACGGAATCGCCCACAGTGGAACCGCCCTCAATCCCTGGGTGATGGCGGAAGATTCCGCCAGGAAAGCGAAACTGATTTCACACTCCCTCGGTTGCCCAACCGACCGTAGCCAAACGCTTCTAAACTGTTTGCGCGACCGTCCGGCCGAGGCAATCGTCCGCCAGGTTCCACTTTTGCTCGACTATCTCTACAATCCGTTCTCACCGCTCGGAGTAGTGATCGAGAGGCAGAGTAAGCTCAACCGGAAACCATTCCTCGTGGACCATCCGGCTGTGCTTTCCCGTAAGGGTAAGCTCACCAAAGTGCCGTTGATATTGTCCGTTACGCAAGGCGAAGGGTTGTACCCGGGAGCCGAATTCATTAGCAAACCGGAGTATTTGCAAGAAATCGATACGCGTTGGAACGAGCTGTTACCAGCCATACTGGACTACAAGTCGGCCGTCCCGGATGCGAAGGAACGAGACCAACTGTCGAAGGCAATCAGTGAGCACTACTTTGGCAAAGAGCGCAAGCTTACGATGGACAATTTTAGGGATTTTGTCTCGGTAAGTATAAATTCTCATTACAATATTCAACATAAGACATTTTAGGAAAAGTTCTTGGTAAGAACTACTCACTCATTTCTTGCCAAGATTACAAGGAATGATTGTTTAAAATAATCTGTAAATTTTACTTATTGAAAAAATATTCATTTTGCTCTAAAATTAAACCCTGGTCGGTCGAGAAAAAAGGTTTATTATCAACAATTTATGAAGAAAGTGTTTAAATTGAAGTGAAAGAATTTGTTCCGTGTATAACGACTCCCCTGAAAATTTTTCAATGTTTATGGAAAAACTATTCAATGTTCATTAAAAAGTTAATACCCATGCATAACCCCCTTAATCTGACTACGGTCATTTTTTTACCAAAAGGGAGTCGTTGCACACGGAAAAATACGTCCTGGTAACATTTATCAATTTAAACCTAAGTAAGCGGCGCTCAATCATCACAAAGAAGGCTAGATGATTGTCATTTGATGATTTTAATAAATCGCATGATACTTCCAAATTATGATCAAAAATCGTATCATCTGAAGAGAAGTATTTTGTTCCGGCAATCATTTTAAAAATATTCACGCCATTCGTTAATCATCGCATATAAACTTATCATCCAACATGTTAAATTGTTTGTGCAAATTCAGCAATCATTTTTAACTGGTGATTTTTGTCAGATCCTTTCCAACCGTCTCTTTTTCGCTGGCACCACTCGAGCGGCCAAGCTGCTGCAACCGCACCTTCCCGTGTACTTCTACTACTTCAACTTCAAAGCGGCCTACGGTATCGGTGAATTGATGTCCGGGTCGGACGAAAACTACGGCGTAGCGCACGGTGACGACACGCTACTAATCTTCCCCAGCCGCATCCGGGACAACCATCCCTACACCGATAAGGAGCTGCGTGTTGTGGCCAACTTTGTCACCCTGTACGATAGCTTCTCTCGCGGTTTGGAACCAAGGTACGGAACGGACGCACTGCCAATGCAGAATGTGACGGGGAAGCTGCAGTTCCTGGAGGTGAAAGCTCCACCGCCGTGTGGAGCAGACTGTAGTGGGGTGCGGGTGGCTTACGGTGTGGGGGACGAACAGTTTTGGGATACGCTTAACTTTAACGATGATCCAACGGTAAAGAAAACCAAAACGCCGACACATACAGAACTGTGAGTGGGTCTCAATTTTGGATGCGGAGAATCAGGCGCGCTCGTGGAACAATTTTATGACGGAACGGAGATAACGGAGAAAGGAAAACTGCCTAATTAGCCGAAAGTTGATAAGCGGATCTATTTGTCTGGTCTGGTTGGCTTGGTAAAATAAAGTGAACCAGTCGATCGAAAAGTTGTCTACTCATCCATTTCCTTTCGCATCCGTCAGTTTTCGTTCTTCCCTCCTGCGATCAACACTTCCTGCCCATTCGTTCGAGGACGAAATCATGTCCTCGACGAGGTTACTTTTGTTTTGGGTGCAAAATGTGGCCTTCTTGTTAATTTTCTTCGACGGCGCAGCATCAAACAGTGTAAAGTTGACCATCAAAAATGGCCCAATTGTCGGCGAGCAACGCTCGAATCACATCGCCTTCGAGGGTATCCCGTACGCTAAGCCACCACTCGGTGCCCTTCGATTTGCCGCCTCGGAACTGCTGGAAGAACGGTGGAACGAGCCAAGAAATGCGACCCAAACCGGGCCGGTGTGCCTGCAGTGGTCACATCTGAAACCGGGTGACGACAAAATAGATGGCGAAGAAGATTGCCTTTTCCTAAACGTCTATACACCGAACCTAACGCTAAGTGACGATCCTTTCCCCACGATCGTGCACCTGCACGGTGGTGCTTTCATGTACGGTGGTGGGGGCTTTTTTCGGCCCGATTTCCTACTCCACCGTCCACTGATACTCGTCACGGTGAACTATCGACTGGGGCCGTTCGGGTTCCTCAGCACCGAGGACGACGTTGTCGGGGGTAATTTTGGGCTGAAAGATCAAGTAACGGCACTGCAATGGGTGCAGAAAAACATCAAATACTTCGGTGGAGACGCGGGCCGGGTTACGCTGTCCGGGTTTTCCGCCGGCGGGGCCAGCGTTCATCTGCACATGCTTTCTCCCCTCTCGCGGGGGCTGTTTCGTAGTGCGATCGGTCACAGTGGATCCGCCTTTAATCCTTGGGTCATGGTTGAGCGGGCCGCGGAGAAGGCAAAGCTAATCGCATCCGGTGTCGGATGCCCTACGAACAACAGTAGAGCATTGTTGGAATGCTTACGCCAGCGACCGGCAAGGGAAATAGTGCGACAGGTGGCGCAATTGCAAGATTTTCTCTACAATCCCTTCTCCCCGTTGGGTGTTGTTGTGGAAAAGCAAGGCAAAAACAACCCGAAGCCATTCCTCGCGGAACAACCACGTGAGCTGACGCGCCGCGGAAAGTTCAGCAAAGTGCCACTCATCCTTTCCGTAACGGAGGCGGAAGGTCTCTACCCAGCGGCGGAGTTTTTCGGCAATGCAAGCTACCTGAAGCACATCAACGCACGTTGGAATGATGTGCTTCCGAGCATCCTGGACTATAAGTACGCCGTACGCGATGTCCACTCGCGCGACGCCCTGTCGGACGTGATAAGAATGCGCTATTTGGGAGAGGGAAATTTGAACGAGCACAATTTCCATCATTTTGTCAGGGTGGGTAAAACGGAATGCTAAAATAGATCGTGGGTAAACAATTACATTACACCTCTCCTGCAGATGGTTTCGAATCGACTCTTCTTCGCCGGTATCACGGAGCAGGCGAAACTGATGCAGCAACACATTCCCGTGTACTTCTACGTCGATCGATATAAAGCTACCTACGGGCTAGCCGAAGCCCTTTCTGGATCAGCAAAGTTTCTCGGTGTACCACACGGTGAAGACATCCTGTTGATTTTACCGAGCAGTTTACGCAATGGATTTCCGTACACAGCGGAGGAGCTAACGATGGTTTCTAAGTTTGTGGATATGTATGAATCGATCGCCTACGGACAACAACCCCGGTTCGGGAAGCAACTGCTCGTGGCCCAGAAGGACGCGGAACGGATTACCTATTTAGAGATAGGCTTTCCCAACAATACCATCGTCACCGCCGACTTCCTTAGCGACGAACCGTTTTGGGGTATTTTGAATTTCAACGATGGTACGACGGTTCCATCCGGTTGAAAGACTTCACACCGTTGGGCGAACCGAAGAGGTACAATAAAATAAACTTTCCTACCTTGTCATCGACCAGTATGGTATTGTAGCGTACATTTTTCGACGATCCGAGCACGACAATGCCCCCGCGCAGGATGTGCTTAACACCATTAACGTTCAAACGCACCTGAAAACGGTAGAGTAGAATGAATATCGAGATAGTACCTGCAAACCAAACTACCTGCAGCAGAAACCTGCGTTAAAATCTTACACTATTTTCCGAAACCATGGTTAACTGGAGGAAACGGCACCTAAACAGAACTGCACAACTTCATGAATATACGCGACACGGACGAAACAATCAACATTTTACCAAAAATAACACGGAATGCTATGTTATTGCGTCTCCGGTTGACAGTTGCCGTTAGCGCTTTCATTGCAATCGCGCCATTTTTATCTGCCAAATGACAGCTACAAAGCACGCTGGCGTTCAAAACGATAAGTTCTATATTGAGGATAGAATAAATCGAAATTTTGAGCACTTTGTGCTATTAATTCGCTGCAGAAATATTCCGCTCTTTGTAGAACTATTATTTGTAGTACTTTTTTGGACTTTATTACCACGGCAACAAATTGTAGTGTCGTTATTCGGCTATTATTACAAATGTTGACCAAGCTGTTTGAAGCTTGATAAACTAACCTTGTTCATCGCTGCTGACAGTTTTGTTCTGTCAGTTTGGAAACCTCGTTTCGACAGTCGAGGTTCCGCATTTTCCAGTTCGGAAAGCACATTCTTGTGACGGACGTCGTGCAGTGCAGTTCATTGTCTGTCTTTTCATTCGTTCAACATGGCTGCAATAAGTGAAACTGTCCTCGACGCGCTGGTGCTAGAACATTTGGCGTCAAAAGATAAAACCTTGGCAGATATTTACCAGAAAAAGTACAAATCGGTAAGTGGCTCATCGTGCTGCGTGTGTTCTTTGAAGTGGAAAGAAGGCGACACAATGTGCGACTCTTAACCTCAATGCGGAGCACCGGCCGGGGGCTCCTGCTGTGAAAACACGTGTTGGCACGAGGTGTGACGCAGTAGTTTAATTCTAGTAGAAAATGAAAATTATAAGGATTTGTAGATGCGTTATCACGTTGAAACCATTACTATGGTGAAATGTACGTGCTGAAACGTGGTTTTAGGCATTTTTATGATCATTCCATAGGAAATCAAGATGGCGTCTTCATTACCTCGTGTTCGCTACCCATTGCTGACACACGCGTTTCCTACCCCCCGCATCGATCAGCCATGCTTCCGCTACATCAATGACCGCGTGGTTTTGGTTGACGCGGGAGACCTTGAAATTCGATGTAATTTTTTGGTACTTCCTGGTACCGGAGCTATGCACAGTAGGGTTGGAGGTTATAATGCCTACTCTTTTCCCTCATTCCAATGCTCCTAGATTAAACCACGCGGGAATCGGGTCTTGCCTAGAGAATGATGCATTTTTACGTTATTCTTGTTTTGGCATTGATTCCAAACAACTTGCGTTTACTAAATTGTATTCTTTTTATAGTTTTTTTTATCATTCGCCATAATTTCTTATTGTTTCTAACCAATCTTCATTGCAGCCAAAACTCCCCAAAGGTTCTCCCCGTCTGGGTGAGATCGTGAAGCACTACCAGGCCACCAAGAAACAGCTTGTGTTGCCCGGCAAAGCCGCTGCGAAGGAAGAATCGTCCGAAGAAGACGAGGAAGATTCCGATGATGATGAGGAGGAAGAGCAGGCGGCAGTAACGCCTGCGAAGAAAGCTGTCACCAACGGTAAGGCCGCCACGAACGGCAATGCGGCTACCAATGGCAAGAAGGCTGCTGCACCGCAGGAGGAAGAGGATGATGATGACGATGATGATGAGGAGGAGGAGGAAGAAGACAGTGACGAAGAGGAGGAAGATACGCCAGCAGTGAAAGCCCCGGTCAAGAAGGTGACTCCGTTAGTGGCCAAGCAACAGCAGGCGGAAGATGATGATGACGATGACGAGGACGACGATGATGAGGATGACGATGACGATGAGGAGGAGGAAGATGAGCAGCCCAAACAGTTGCCGCTGGTCAAGCCGGGACAGAAACGCAAGGCCGAAGAAAAGCAGGACAACGAAGAGGAAGACGATGAAGATGAGGACGACGAGGAGGAAGAGGAGGAAGAGGCCGAAGAGCAGAAACCTCCAGCAAAGAAAGCAAACAAACAGGAGCCTCAAGGCAAGGTAAGTGAAGTACAATTTTTATGTATTTTTTTGTTTTTTAAAGATAAACCCTATTTGTACGCAATCTACAAAAACACAGTTGTGGCCATAATCATTGAATTAGGCGGGATAAATTTGCTTTACCGCATGGAAACGCGGTCCCATGGCATTCCTTTTATCACTTTCTTGTTAGGATTGTCAGGACCTTAGACTTTGGTTGGTGGGACTTGGTGAAACACGTTTCGTTTTCAACCTTAGATTGGAGCTCTATCAGGTGGGCCTAGAAGAGAACAAAATAACGTCTTCTATTCCCTTAATCCGATGCTCCTACAGAAAACCACGGGGGAATCGCGCCTTTCTTGGGAATGGTCATTTCCCTGACCACCTCCTGTGTTGGCAAAGATTCCGGACAATTCATCCGCGTAAAGCGCGCATGCAATGGCATTGAAAGGCGGGATAAATTTGCTCTACCGCATGGAAACGCGGTTCCAAAGACATTCCTTATCAGTTTCTTGTAAGGACCGTCAGGACCGTAATGTATTTCTTGGCGTGCAGAGAGAGTGGGGGACGTGGTGAAACACGTTTCGTTTTCAACCTTAGATTGGAGCTCTTTCAGGTGGGCCTAGAAGAGAACAAAATAACGTCTTCTATTCCCTTAATCCGATGCTCCTAGAGAAAACCATTGGGGGAATCGCGCCTTTATTGGGAATGGTCATCTCCCTGACCACCTCCTGTGTTGGCAAAGATTCCGAACAGTTCATGAGCGTAATGCGCATGCGACGATGTACCGATGGGAAGAACAGAAATAGAGAAAAGTGCACTTCATATATTTTTTGCCGTTACCATTTTTGTGTAGGTTTGCTTTAGTTTCCGTGTACTAAACATACCGTGTCTCCGTTTTTGTTTACAACTGTTACGTTGTTTTTCGGATTGCCTTTCCGCTTATTTATTTCAATTAGGATTGTTCCTTCTGGTTTAACTGTGGATTGTCGAAAATTGCTTGCAACGATCACAGTTGTGGTTTGGGTATTTTTTAATTTAATATCAAACGATGTTGAACGCAAGTGCTAATATTTTTCTCTATTTCTCTTTCCTTCTTTCTTTCTCGATCCTCTCGCACTCATTATGACAGCAGCAAAACGACCGGAAATCGTTCGGCGGTTACAACAACGGTGACCAGTCGAATAACAAGAAGCCGGGAGATTGGGATTGCCCGAGCTGCGGAATGTCGAACTTCCGAAGCCGAACGAGCTGCTTCAAGTGCCAGGAAGCCAATCCGAATCCGTCCAGCGACTGGACGTGCCCCAGCTGCAACTCCTCCAACTTTGAGACCCGTTGGAGTTGCCGCCAGTGTCAAACGAAGAACCCGAACAGTACCGGTCGTCCTGAACGGAAAAGCTTCGGTGACGAAGGCGGACGGGGCGGCGGCGGTCGCGGTGGATTCCGTGGAGCCGGTCGCGGTGGTGGTGGTGGTGGATTTGGCCGTGGCCGTGGAGGTGGTGGTGGATTTGGTCGTGGCCGTGGAGGCGGTGGTGGATTCGACCGTGGGGGCCGTGGCGCCGGAGGCCGGGGAGGTGGCCGAGGATTCAATCGAGGAGGAGGAGGAGGTTTTGGCGGAGCATCAAACAACAGAAAAACTTTCGATGAGTAGGGACCGTAATATTCACTTGGTCTACTCATTATATCCTGTTAGTCGTAATGTTTACGTTCAGAAGATTTAGATTGTATTTTTTTGTTTTTAAGTGAAACAAACATAACATTTTCTAACAGCAACACAAAGCACCTCGGGTATCGAGTTTAGGAGCGGCCATTTCCCTATTTGTTTGAGCCCTGCATTGAAAGGATATGCGCTTTGTATATTAGAAAACGTGGCATTTATTGCAGGATAAAAGTTTTAGATCAGACCCGTTCAGAAGTGAGGCACATGAACGGCATTCAAGAGAAGACAAGTTAAAACCGATGTCATACGTCGCTAGTTGATGTTATAATTCACCAATCAACAAGATAAGGATTTTTCTAGAATTAAGAAGTTTTGTGTGTTCTTAAACAAAACACGAAAAAAAATAAGGATTGAACCCCCAAACCCCCTACCCTTCCCCCTCTACAGTGTCTCAGACGTTTAGGAGAAACGAAATTGTACCGCATCGGGCAACTAATACATTACATAGTTTGTATTATTGCTGGTGTTTATAACATCATTCTTCTATATTGTCATACAAATATACAACTACAATTATCTCACTTAACACCGAAAACAATGGATTATGGCTTTTATTTCTGTGTGGGATTATCCTTCTTCAAAAGGGTGGCGAAATATTACTTGTATGAATATCGATTTTCTCTCTTAGTTCTGCCTTTGTTCATAACGTAATTTTTCCCGTGTCATGAAATTTTATTTTATTCAGACTCCAACTAAACCTACAACAATGGCCAACGGTAAACCGGTCCTTAACGGAAAGCCAACATCTAATGGAAAGGCGCAAGAACAATCTTCAAGCGAGGAAGATTCGTCGAGTGAGGAAGAGGAGACGGTAAAGAAACCGGCTACTCCTGCTAAGGGAGTAGCAAAACCGCCAGCGGTTGCCTCCAAGAAAGCAGAATCTTCAGATGACAGCTCCGATGATAGTTCAGAGGAAGATGCTCCGAAGCCGGCATCGAAGGTAGCAGTGCCAGCTAATAAAGCTACCCCCGCAAAGGTCGCTCCAGCGAAAGCTACTCCGGCAAAGGCCACTCCTGCGAAAGCTACTCCAGCTAAAGGAGTAGCGAAACCAGCAGCTGCTGTTGCTCAAAAGAAGCAGGAATCTTCGGATGATAGCTCGGACGATAGCTCTAATGAAGAAGATGCAAAGCCGGCATTGAAAGCTTCGGCCAACACACCAGCGAAAGCACCTGCAAAAGCAGCTCCTGTAGTTGCTAAGAAACAGCAGGAAGAATCTAGCAGTGACGATTCGTCAAGCGAAGAGGAAACTGCGAAGAAACCAGTTGCTCCAGCAAAAGCAACTCCGGCAAAGACACCTGCTAAGGTCGCTCCTGCCGTTGCTAAGAAACAGCAGGAAGAGTCGAGCAGTGATGATTCGTCAAGCGAAGAGGAAACTGCGAAGAAACCCGCTGCTCCAGCAAAAGCTACTCCAGCTAAAGTAGTAGCGAAACCAGCAGCTGCTGTTGCTCAAAAGAAGCAGGAATCTTCTGATGATAGCTCGGACGATAGCTCTGATGAAGAAGATGCAAAGCCGGCAATGAAAGCTTCCGCAAACACACCAGCGAAAGCACCTGCAAAAGCTGCTCCTGTAAAGACACCTGCTAAGGTTGCTCCTGTAGTTGCTAAGAAACAACAGGAAGAATCGAGCAGTGATGATTCGTCAAGCGAAGAGGAAACTGCAAAGAAACCAGCTGCTCCAGCAAAAGCAACACCAGCAAAGACACCTGCTAAGGTCGCTCCTGTCGTTGCTAAGAAACAGCAGGAAGAATCGAGCAGTGACGATTCGTCAAGCGAAGAGGAAACTGCCAAGAAACCAGCAGCTCCAGTCAAAGCAGCTGTAGCCAAACCAACAGCAGCTGCTGCTAAGAAGCAAGAATCTTCAGACAGCTCCGATGATAGCTCGGACGAGGAAGATGCGAAACCAGCGGCGGCGAACAAGTCGGCCAAGGCTCCGGTGAAGTCCGCTCCTCCTGTTACTAAGAAAAAGAAGAATCGAGCAGCGACGATTCTTCCAGTGACGAGGAAACTGCAAAGAAACCGGCCGCTCCAACTAAAGCATCAGCGAAACCATCTACCGTGGCTGTTGCTGCTCAGAAAAAGAAGGAAGAATCTTCGGATGACAGCTCGGACGATGATTCTGATGATGAGGAGGCGCCGAAGACAGCCACGAAAGCAGCACAGAAGACCCCCGCTGTTGTGCCGGTAGTTGTGAAGAAAAAGCAGCAGGAATCAAGCAGCGACGACGATTCATCCAGTGAGGAGGAAGAGGTGGATACGGCGAAGAAACCTGCAGTAGTTGCGAAACCAGTAGCATCGACAACCGCTGCCGCGAAAAGGAAACAAGAATCATCATCCGAAGAAAGTTCGGATGACAGTTCGGACGAGGAACCGGCGAGTAAGAAACCGGCTCTAATTGCATCGACGCCGAAGCCGGCCGCGACAAAGGCGACAACTGCTGGCGGAACGAACCAAGCGGGACAGAAGCGTAAGGCTGAAAGCAGTCCTGGTGTAAATACGCCGGCAAAGAAACCCAACACCTACAGCAACTTTGTTCGTGGTGGCGAGCAGGAAGGAACCATCAATAAGGTAACTCACGTTTTTTCGTACTTAAATTACACGTTTTAAGTTCTCTGTTACAAAAACAAAAACATTAATTTTTTCTTCATAAAACCATTTTTACAGTTTGAAACGCCCCCGAACAAACAGAACCCCAAACAGCAGAACGGCTCCAGTAGCAGCGGTTTTGGCGGAAGTGGGCAGAAATCATTCGCGAACAGCGACGAACGGCGTGGCGTTCAAAGGTTTCGCCGCGTGAAAGAGGAAGCCATTGAGATCGACAACAGGTTGAAGGATAATTCCTACGAAGCTAAGGTAAGTACTGAACACAACAGCGAGCGGTGGGGTTTGGGAGCATGGGGTAATCATAATTTACGATTGTTGGTCATTCCTGTCCCGCGCCTCGTACATCTCAGTTCGCGAAACGAAAAAGCTCGGAAGCTGGTGTTAAAACAATTGAAATGCATTGTCATCCAGCGATATTTGGACGTAGCGTGGCATATTTGTTTTGCGGGGGTAGAAGCTCATCCGAAACCAGAAGACCGGTCTCCAGCGACAGGTAATTGGGTGTGCCTTTCTTAATCAGTACCGGTTACTCTCAGAATGTGTTGGCAAAAGATTGTGAAATTTGGTGTCAACAATCTTCAACACATCAATTCAATTTTCTTTGTTCAATTCATTACTGGGATGCAGATAACTGTGGATTATGATTTCTTCATTCTCTTTGAACCTGTTTGAGTGAATAAAGTAAATCACACTTCTTTCATCCTTCCACCCTCCCCCCTGCTGTCTATCAATTAGAGAAAATCTATTAAACCAAAAGAATCGAGTAAGTCAAACGAACGCCTTGGCAATTGGAAGTGCACCGGTTGTTCCGGTAACAACTATACCACACAAGTCGCATGCTCCCACTGCAAGCTGGCTCGGACAGTTTGGAACTGTAGGCACTGTCAGGAAACAAACCCAGTGAAGAACAGGCGGGCGGATAAATGCAAAAGGTGCGAAAAGGATGCCCCGTACGTTGTGACGCGTTTGTTTGTCAACCGAAAAACTCTCTGCTGGATTTGCGAGAAGTGCAAGAACTGGAATCGGCCAAGCTCTGATATGTGTCAATGCACCAAGCGGGAAGAGGAAACGCGGAAAAAAGCGGAAGCCGCTGCCGCCGCCGCAGCCGCAGCCGAAGCCGCAGCCGCATATGCCGCCCGAAACAACGCAATCGCCGCCAGGGAGGCCAGAGCCGCCGCCAGATTCATCGCCGCCAGGGCAGCACGGAAAGTACAAATAGAGCGAAAGGCTGGCGATTGGGTGTGCGAAGATTGTAAGAAAATGAATTTCTCAAAGAACCTGAAGTGCGTCAGATGCTCGGCACTGAAGCCACTCTAAAAACCCTCTGTCAACCGAGGAATGATCGATAGTCGTAAATTATGTTGCCAAATGTACGTTTCACCTGCAAATAGTTTAGCCACTAGCATTAAGACACAAGACACATGATTTTTAACTTTCATTTATTCATTATTTATTTTCCAGCAAAACGCTCACGGTGCGTACGGAGAAAAGGCGAATCAGGTGCTGAAGCACGTCAAAGGGAAAATGTTCCGCCACGAGAAGACGAAAAAGAAGCGCTCCGGATACTTTGGTGGGATGATCGATACGTCCGTCAACTCGATCAAATTCGACAATTGA
Ortholog: Anopheles gambiae | AGAP005370-PA | ortholog one-one
Aedes aegypti | AAEL012509-PA | ortholog many-one
Culex quinquefasciatus | CPIJ006908-PA | ortholog many-one
Drosophila melanogaster | FBpp0075735 | ortholog many-many
Drosophila melanogaster | FBpp0075736 | ortholog many-many
GO: GO:0005622:intracellular
GO:0008270:zinc ion binding
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 0.02642623 0.2799753558 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400