ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB48878.1'
Gene ID: ZHAS_00017140
Protein ID: KFB48878.1
Description: Glutathione S-transferases, Unclassified
Location: KE525342.1:568404:569175:reverse strand[JBrowse]
Sequence: >ZHAS_00017140  (627 bp)    All exons in this region
ATGAAGCTGTACGCCGTTTCCGATGGACCACCATCTTTGTCCGTCCGTATGGCCCTGGAAGCGCTCAACATCTCGTATGAGCTTGTTAATGTCGATTACGGAAAGGCCGAACATCTGACGGAAGATTATGCAAAGGTGAGTGGAGAGTGGGCACTTGCTTTTAATTTGTTAAAAACTTCATGAGCTTCGGTTTGGTTTGTCGTAGATGAACCCGCAGAAGGAAATCCCCGTCCTGGACGACGATGGTTTTTTCCTGAGCGAAAGTAACGCCATCCTGCAGTACCTGTGCGACAAGTACGCCCCGGACAGCGAGCTGTATCCGAAGGAGCCCAAGCAGCGTGCGCTCGTCAACCATCGTCTTTGCTTCAACCTGAGCTTCTTCTACCCACAAATATCCGCCTACGTCATGGCTCCCATTTTCTTCGACTACCAGCGCACGGACATCGGATTGAAAAAGCTGACCCTCGCCCTGGAAGCGTTCGAGACGTACCTGAAGAAGTCCGGCTCAACGTACGTTGCGGGCGATTCGCTGACAATCGCCGACTTTCCACTTGTTGCCTCGGTGATGTGCCTTGAGGCGATCGAGTTTGATGTCAGCGGAAAGTATCCGACCGTCTTCAAATGGTACAGCGGTTTTAAGACCGCCTACCCGAAGCTGTGGGCCATCGCTGCCAAGGGAATGGAGGAAATCGCTGAGTTCGAGAAGAACCCACCGGATCTGACCGGAATGGTCCACCCGATTCATCCGATCCGCAAGGTCGCATCGAAGTAA
Ortholog: Anopheles gambiae | AGAP000947-PA | ortholog one-one
Aedes aegypti | AAEL011752-PA | ortholog one-one
Culex quinquefasciatus | CPIJ009434-PA | ortholog one-one
Drosophila melanogaster | FBpp0290855 | ortholog one-one
GO: NA
KEGG: Orthology:K00799
Pathway name:Metabolism of xenobiotics by cytochrome P450
Pathway map:ko00980