ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB49308.1'
Gene ID: ZHAS_00017424
Protein ID: KFB49308.1
Description: AGAP006497-PA-like protein
Location: KE525344.1:582178:584607:forward strand[JBrowse]
Sequence: >ZHAS_00017424  (1161 bp)    All exons in this region
ATGGAGGTGGATGGATGGGTTTTCGCCCTTTTGTTTCGTTTGTTTATTCTAAACATTTTCCCGTGTTCATCTCAGGTGGCTCCGTTACTGCTGGCCAGACGCATCCAGGTCGTCAACATCAGCCCCGAGGAGGCCCAGCAGTACATCACCCAGCAGAGTCTGGATCTTCGGTACGCACCGAAGCTCGGAGAACATCCGCTGGGCTACACGCGAAACATTCAGGATCCGTCGGAGGCGCGCTTCTACTACAACGGACGGGTGATCGAGCACCCGGAGGACTTCGTGGAGGAAGAGTACGAGGCGAAGCAGTTCCACGGGCAGGTAAGGACGGGGGAGGAGAACGAGCACTGTAAAGTTAAATTATAGTCCGACCTAATGGATTACAAATTAAACAAAACACTCAATTGGTTTGTCTTTGAAGATATAAAGTTAAAGTTGAAATTACGATGAAAATACGATACTAATGTAATCAAATAGAATTTTCTCAGAATTTTCATTTCATTTATTTTTCGTTGTCAGCTGTAACACTTTACATTTATTTATCCGGATTTACAAATGTTTTATTTGGCTTACAAACTTTTCTTTTTCAATCATCTCAGAAAATTAACTGTCCTAATTTTAGTTTCGACAAATTGTTTTTACACGTTAACTGCCACGGCTGCATTTTTGATAACCATCGGACATTATTTGTAAAATGTAGCGAACAAATTTTTTATAATGAAAGCTGTAAAAATCTCAAAATTTTATTCTTCGGGAAGCTTAGTCTTAGCTTAATTTTTGCAAACCTTTGGATTAATGCATTTTATAAATATTGTCAAAGACGAATGTGTCTGTTAAAGCGCAAAATCTCTATAATAAAAAAATATTACAAACATTTTTTTAAATTAATATATTGAAATCTATAATTTAAAAAGCTTGACAATCAAAGTGTTAATTTAATTGAAAACATGCTGTCTCCTTAAGACAAAATTTTTCAATCAAAAGCTGGTTGGAAATTTACCTTTAAATTGTTGTAAGATTGTTTTACGTAGCGTAGAATATCATCTGATTATTCGCCGTTTAGAAGAAGTATGATACAGGAAGAAGAAGTCAAGAAGAAGAAGTATGATACAGGATTCTGTAATTTGTCTTTAGTATACAAAGAAGATTTGCACAACCCCATACAAAAAGAATACAAAGGTATGCTTAAAAAAAAATAAAATAAAAAGTCTGACGTGTTCGGAACTTAACCACGTTTTATACGTATAAACTGATGCGGCCTGTTTGTTCTTTACTTACAGTTTTACATTTTGGCAGGTCACGTCTTGGAAGCTTGTCTCGTGATGACCCCAAATATTCATTTTAATTGCTATCTTCTTATTCTTATCTTCTGAGATTAGTCAACAAAGTATAGTTCAATTGTTTTTCGTTAAATTTGCACGAGTAAGGATGGATTTCGAACAATTAGGTTAAATTTTATACAAATGGGTTTCTCTTTAATATTTGAGTATTTGTGATGTCATTAACTCTGCTCATCTCTTTGAACTCATTACATTATATTCATCGGAAGATTATCTGAGCGACCATTTTACTCTACTTTTCCTTCTACAGGATGGCCTCGGCCGGGCAATGTTCGGCTACAGTGACCACAACCAGGCTCGACTGGAAGCTCGCAACGCGAACGGCGAGGTGCGTGGCTCATACCAGTACGTGAACCCGTTCGGCGAGGACGTGATCGTGCAGTACTGGTCCGACGGGCTCGGTTTCCACCAGATCGACAACCAGCCGGAAGTTCGCCTGCAACCCGTCACCGATACGCCAGAGGTCCGCGAGGCTCGCCTGGCACATCTGAAGGCCTGGGAGGAAGCGGCCAGTCTGGCCCGAGCCAATCCGGACGTGACGTCCTCAGATGGTGCCAGTGACCCCGCACGATACCCTGCCGTGCAGAGCAATGCAGTCGAGCAGGAACCGGAGCAGGAGGACGAGATCCTGGCGGCCGTTTCGAATCAACACCAGAGTCTCATCCGCTATCCGAGCCTTCCGTACACGGACCACATTTCGCCCGAAGGTTCTGCGAAGGGAGTGCTGTCGGACGATGGGGTCGTGGTGGAGGCAGAGGCCCGCAGCTTGAAGAAGCGCCAGAATGGCGAGGACACCGAAGAGACGGTTCCGGCCGACCCGAAGGGATTCTTCTACAGCTTCGACTACCCGGTGCACTTGGTGGCGGAGAGCGCGGCCAAAAAGGCGGCCCGGGGAGGCACCAGCGACCGATTCGGCGAGACCCCACAGGAGTCGACGGTGGTGGAAACGAAGGCATCCGTTCCGACGGACGATCGCGTTTCGCTGAAAGCGGTCCTGAGTGGAGAAACGCTTGTCGATGCCGTCCATGACGCGCAGGTTTCGCCGAAGCAGAAGCTGGCGGTGGCGGCGGCGGCAGTAAAGCAGGCCTAA
Ortholog: Anopheles gambiae | AGAP006497-PA | ortholog one-one
Aedes aegypti | AAEL004588-PA | ortholog one-one
Culex quinquefasciatus | CPIJ007441-PA | ortholog one-many
Culex quinquefasciatus | CPIJ019541-PA | ortholog one-many
Drosophila melanogaster | FBpp0076183 | ortholog one-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Down -1.08759856 0.4053270064 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400