ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB49529.1'
Gene ID: ZHAS_00017734
Protein ID: KFB49529.1
Description: cytochrome P450, CYP 4C27
Location: KE525346.1:742713:749144:forward strand[JBrowse]
Sequence: >ZHAS_00017734  (1521 bp)    All exons in this region
ATGTCGGAGCTTCACACGATCGTGCACGGGGTGTTGGTGTTTCTGGTGTTCGCCCCGTTTCTGCACTGGCTCATGAAACGATGGCAGCTGAGCAAGATCTACGATGTTATACCCGGCCCGAAGGCGTACCCGTTGATCGGAACGATGTACACGTTCTTCGGCAAGAAGCATCACGGTAAGCTGAAGCAGACGGTAATAATTGGGTTAAATAATAACTGGCAAGATCGTTATCTGAAAAATACAGTACACGAAGCAAAGTGCAAAGTACAGAAATGAATATGACATGCAGATAAAGATAAGATTGCTCATCTGGTTGTTCATAACTATGGTGTTGTAAAGAAACCACACCAAAAATAGATACCCGAACTAGGATTGCTACTAGGTCGAATTTCATGTGGAAAATTTATGTTTTTACAATGAAAAAAGTCAGTGAAACTTTCAGTCTAGAAATTTTGAATCATAAAACCAAAAACCAACACCAAAAATTAAATAACCTGTGAATTCAGTCTCTCATAAATGAGAGTTTCTTTCATAAAAAACTTTGTCACGTCGATGAAGCGCAAATTATATATTTTTATCTAGAATAAAATTAAATTTAATATTCTACGATTCACTTCAATATATCATTTTCAAAAAGATAGGATTGTTTATCAAGTGATCATAAGAAACTGTAGAAGTTTGCATGAAAGGTTCCACTGTAGGAAAGTCTATGTATTGATTAAAAAACCTGACAAAAATCAAATTATTGGTTGGTTATCTTACCTATAGAGCTAAGAATGGTTTAATAAACCCTTTAATACGTACTTACTTTTATTTTTGTAAGGTATTTTTTAAAAGTATTTTGTCAACTTTAATTTTTGTTAGCAGGTCTTGAGGGTACAACAATCAACTTTAATTTTAATTTACAGGTCTTTAGGGTATAACAATCTGGTAAAATGTTCATTTTTGCATGCAAAACTATTGGAATCAAATCACACCTAAGACAAAAACTTTTAAAATTTTTAAGACAAACGTTCGTTTCGTTGAAAACCTACCCAAGCAGTAAAATTATTCTCATACACTGACCACTTATCGTGTTGAACGTGTTTGCGAGCGAAAATTAATTCCCACAGTCAAAGTCATATGGAGTAAAGGTTGCCGCACATTATCTGGTAGATTACAGCGTATCTGGTTGAAGCTACATCAGCAATTACTCTTTAATTACTCTGTAGAACCATATCTATGGTGCTAAAACAGGTTACTCATCATTTCAATCTACTGAAAACACGGTTCTTTGTTCAAAGGAGTGGTAATGTTAGCGATAAAGCACCTGTACTATGCACATGGCATTATTTCAACTACCTCTTCTTACAACCAACCCAAAAGTGTGTAAATGTGTTTCGCTTACGAACTACCATTTGTCAACCCGTTTTTGCAGAGATTTTCTACGTGATCGACAAGAGAACGCGCACCTACCCGGACATCCATCGCGTGTGGACGGCGTTGGTGCCCGAGGTGCGGATCAGCAAGGCGGAGTACGTCGAGCAGGTGATCAGCTCCAGCAAGCACATCGAAAAGTCCACCATGTATCGCTTCCTGCACGACTGGCTCGGCGAGGGTCTGCTCACCTCTAAAGGTATGATGTCCTCGGTTCGGTGGCGAAAAGCGTTCCCATGCCCATAATGTTTGACATTTTTCTTTCTATCCTACTTCTTGCCCGAAATGTTCGGTTCGTGTCTGGGAATGCTTTTGAATCGTTTCCCTCCGGGCGTTTCCCTTGCGGACGCAACAGGTGAGCGCTGGTTCCAGCACCGTAAGCTCATCACGCCGACCTTCCACTTCAACATTCTGGATGGATTCTGTGACGTTTTCGCGGAGAACAGCGCGGAGATGGTGGAGCTGCTGAAGCCCCACGCCGACACCGGCAAACCGGTCAACGTGTACCCGTTCATCGCGAAGCTAACGCTGGACATTATTTGCGGTAAGTGCGCCTTCCCATGCGCTGGTTTACGACAAGACGGATTGTGCGGGCGCCATGGATTACCGATTGGACCGATGCCAATGGGCTTGAGCCTACCAGGGATGTCATGTCCCCGCGATAGTGCTCACGATGTATGATGATGTATGCTCGGGAGCTCCAACGGAGGAGCATTGTTGCCGCGCGTGATCCTTCCCTTGTCGACACGGTCTTTAATGGATTGTTGTGGTCGTTTTTCATCCCCTTTCTGCTTCTTTCGGTCAAACACAACGCGAATGCTGCCCACCGAAAACGGATATCACAGAAACGGCAATGGGTGTGAAGGTGAACGCCCAGAGCGAGGGCGAGGACAACGTCTACGTCAAGGCGGTCTACGAGTAAGTACCGGGACATTCCGGGACACTGCGGTTTAAGGTGGTTTTGGTTACTTATCCCAGATTCCTCCCATGAGCACTTTTTCATGTCCTTCCTTTGCAGGCTAAGCAGACTGTTCCTTGAGCGTTTGGTTCGGCCATGGCTGCACGTGAACTTTATCTGGAATCGGTCACGATTTGCGAAGCGCTACACACACGCGCTGAACACGGTGCACAACTACACGAGGGAGGTAGGTACTCAAGTGGCGGGATAGGATTGTCCTAAATGCTTGTTAATTACAACTAGTGTTCGTTTTTTGAGTCCTCTTCAAAGTTGTTTTCTGGAGAAGAGTATCGAAATGCTAATGAAAATATCTGTTTTGATGGTGTTAAGCGAGTTGAACTATGTTATGCATAGGATTTAATTTCTGATCGATTCTGTTTTCCATATCAAGCTCCAAAAAGGGGAAAGGGTGACTAAATTCATCGGTTGAGAAAGATGCTCCAGTATGTTTGTAGTTGAATTTCGCAGTTAAAAATGGTTGAAAGAATAGAATAAGTTCACTGGCATGTTTAACACATCGTGTGTAAATTTCATTGCTCTACATTTACATCTATCAGAGTAAACAGAATGAATCAATTTATTCCAGAAGTCATGTAAGATTTCCTCAAAATAATTAAAGCTATAAAAAGAGTTCAAACATCAAGTAGGAGAAAATAAGCATCGGATGTGCAGCACAAGGCTGTAAATGATTGGCAAAATACTCAAGTTTACCAATCAATTTTAGTATGTGGCACAATCCTAACTCAACTAACTCTAGATAATTTACAGTGTTCGTTCGTAACTCACTGATGATACATTTTCTGTCACATTAGAGTTCATGGAGTTGGAACAAAATTAAAATATATCAAATTTCTGAAAAAGGTCTATATCAAAAATCATAAACGTACTCTTACTCTTACATATATAAACCTTTTTTTCACATTCTTTAAGGACGTGTGCAAAAGAGAGCTGCTTAAAATCATGTTTTATTTAAGTACCAATTTGAGAGGTTTATTATCGATTTGTTACCTTTCGGTAGTCGAAGGCTTGAAGAAAATTTCGTTCTGTGGAAATGTTGGGCATATTTTTCATTAATGGCCTGCAAAAAGTTGTTTCCTTCAGAGGTTCATTTTCCCCCACCTTAGCCTAATGGCTGTTCCATCGTCCTACTGCCTACAACCAATGAACACCTTTATCGAACGACGCTAGTAACGTTTCGTATAATGTAAAGCAAAAGTGCCTGATGAGAATGTCCAGTCCGGCAAAAGGGAAATTAAAGTACTCGAGACCATCGTTTGCGCCGTTTAATTGTCTGGCTTGTTCCACGCTGCGCCAATCAAGTGGCTCGAAGACACCAGAAGGAGCACTATCAGCAGCAGCAGCAGCAGGTGGTCCTACGCGTCCATTCCATAGCGTTCCGTTCGCCTTTCGGAAGGCACCAGCTGTTGTGCAACCACATTAATTGTCAGTCAACATTCTCGCCCCGGTTAGCACCGGTTTTCCCGGAGCGCTTTCTTCAAAGCGCAATAGAATTTCGCTCCAGTTTCGCGTGGACCCCGTTTGTGGAATCGTTTGGGCTCCCGAGTGCTCCCCAAACCCTCCCTCGTTGGGTTCACTTCCTTTTCACCCTTTGAACCCTTTGGTCGACGTCGATCCTCACTGGCATGCAATCACTGTAATGCCATCAATTACCGAAAGCACCTTGCAACCGGATTGCAATCACCGTATCTCGTCCGTTTGTGTGTGTCCCTTTGTGCATACACCGGCATCCTTGCCCCAGAATGATGTCCTTCGTAGTGTACCTCTCTCTCTCTGCACTGCTGTCATTCGCTTCCGCTTCGATTGCAATCGTCCGGCCCGGGCTTGCCTTCGCCATTTCCGGTGCACATTTTGCCGCTGTTCAATGAAGCACCCCGTTGGGTTCGGGATCGGACAATGGTCCAATGCAACAACGGTTCCGGGAGGTTCTTTTCTTTCCGCATCGCTACGGCCAGTGCCATTCCTTTGTGCCTTTCGCAACTGGTGCCATTTTCCTCCAGTTTTCCTCCCGACATCTAACGAACCCCGGGTTGGCTCGATCCTCGATTGACAATTTCACGATATCTTTCCGTTCAACCGCTCACTCGTTACCTTCCACCCGTGTGATTTCTTCACGGACACACTTTGTTTCGTGGCGAATAAAAATGAATAAATAAAACATCCCTGTCCCTCGATTCCAGGTCATCCGGGACCGGAAGACGGCGCTCGAGACGAAGCAGAGCACCGGCGACGACGGTGAAACGTTTGGCCGCAAGAAACGGTTGGCCTTCCTCGATCTGCTGCTGGAGGGCAATCAGGCGAGCAAACTGCTGACCGACGAGGACGTGCGCGAAGAGGTGGACACTTTCATGTTCGAGGTAAGTAAAAATGCGTTGAAATACCTCAATCGATAATCAGGCCGTCGCTCTCATTGATATTCGCCCCGGGGAAATCAATGGAATGCAATAAGTTGCGCGTAAAATTAATTGAGCCAGTTTTTAATAGTTGCCAACCGTCGTACAAAAGTTAAAACTGTACAATTTCACAAAATTTCCAATACAACACAGCAGACCCTTTTCGATAATCAATGCTTTTAATCAGCATTTGTTGCCGTAGGTTAATTGAAAAATTAAACTTAAATGTCGCTTGGTGATTGCATTTAGGTTTAATTTTCTTCACATCTTAAATTTAACTCGCTTTAAACTTCATTCAATTTGGTTTAAACACAATATACTAAAGGTATACCTCGTAATAAAGAGACTCGAAAAAGGAATCAATACCGATAAGCATACACATAAAATTTCACGCACCAAATCAATATACCAATCGATCTTTCACTTCGCGATTGGAGAAATGATTTCGTTTTGCTGCGGGTTATTGTTTCACTTTCTGTCCAAATTCCCCCACCACATGCTGTGTTGCCTTTTGCCGAACAAACAAACAAGCAAACAAACAAGGTCCTACGCGTTCCACCATCCGTTACCAAGTTCAGCAGTAAAATCGTGGCGAGAAAGAGGAGAAAAAAAGATAAACCACCCCCAGAAAACAGGGCCACCGTTCAACATGGTAACGGTATCATTGGCAATTTGTTGTCCAATTTTCCACCCGGTAGCTTCATTCAGCCCCGGTCCGAAACACCGAAAACCGAAGCCAGGGCAGATCCGTAAAATTACACCTCAGCGACCATTCGATCATAATGTACGCAGTGGAGGCCATGTGTTTGAGTGTGTTTTTTTTTCTGCGTTCGGAAGTCTTTCCCCACACCCGGTAGAAGGATTCAAAGGGAGAGGGAGGGTGAAAAGCAATGGACGGCACCGGTTACAGCGTAGCCAATTTGTTCTCTTCGACAGGGACACGACACGACGACAGCTGGCATCAGCTGGGTGCTGTTTCTGCTCGCGCTCCATCCGGAGATCCAGGATCGGGTGTACGAGGAAATTGAGTCCATTTTCCCGGACGGCAGCGACCGGCCGGCGACGATGCAGGACCTGAACGAGATGAAGCTGCTCGAGCGGTGCATCAAGGAGTCGCTCCGGCTCTACCCCTCGGTGTCGTTCTTCGGTCGGACGCTGAGCGACGATGTTCAGCTCGCCGGATTCCACGTGCCGGCGAAGACCATCATCGGTATCCACGCGTACCACGTGCACCGGGACGAAAGGTAAGGGAGGAGAACAAGAAGCGAACTCCCCGTGCGTTGTAATCACGCAAAAGAAAAATGTGTTACCCGCACGGGGTCAAGATGGGATCCGTTCGATTGATTTGTTCCATCTCACTCCATCACGCGCAGATTCTACCCCGACGCGGAGCGCTTCGATCCGGATCGGTTTCTGCCGGAAAACACGGAAAATCGCCACCCGTACGCGTACATCCCGTTCAGTGCCGGGCCGCGGAACTGCATCGGTCAAAAGTTTGCCCTGCTCGAGGAGAAGAGCATCGTTTCGGGCGTCCTGCGACGGTTCCGGCTGCGGTCGGCTCGAACACGCGAAGAGCAGACCATCATGCACGAGCTTATCACGCGCCCAAAGGATGGCATCCTGCTGTACCTGGAGTCCCGCAAATGA
Ortholog: Anopheles gambiae | AGAP009246-PA | ortholog one-one
Aedes aegypti | AAEL012266-PA | ortholog many-one
Culex quinquefasciatus | CPIJ001810-PA | ortholog many-many
Culex quinquefasciatus | CPIJ018716-PA | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: Orthology:K07427
Pathway name:
Pathway map:NA