ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB49799.1'
Gene ID: ZHAS_00017817
Protein ID: KFB49799.1
Description: cytochrome P450, CYP 9J52
Location: KE525347.1:1436281:1440730:reverse strand[JBrowse]
Sequence: >ZHAS_00017817  (1626 bp)    All exons in this region
ATGGAGATCGATCTGATGATCCTGTTGCCATTGTTGGCAATCTTGTACACAGTCTACTATTACCTGACGAAGGATAATAAATACTTCCATGATAAGCCAATACCTTCGATGGCGGTGCAGCCTCTGTTTGGAAGCTCCGGTCGGTTGATGATGAAAAAGACTTCGTTTCACGAGTGGATCATCGAAATCTACAACAAGTATCCGTTGGTAAAGTAAGTGTTGCGTTAAAAACATCCATATAATTTCAGAATGCTTTTATATCAAGCAATTTTTTTTATGCCAATTTCTCTCCATTTAGAGTGTTCGGAATGCACGACCTTACAACACCGGTGTTCGTTGTTCGCGATCCAGAGTTGATCAAGCGAATCGGCGTCAAGGATTTTGAATACTTCATCAACCACCGACCGCTATTCGGTAGTTCCGAAAACAACAACTCGCACTCGCTGTTCAGTAAAACGTTGGTCGCCCTTAACGATCAAAAGTGGCGCGATATGAGGGCCACTCTCAGTCCTGCCTTCACCGGAAGTAAGATGCGGCAGATGTTCGAACTGGTTGGTGAATGTTGTGAGAGTATGGTTAAGTTCTATCAGAACGAAGTGCGCACTAAAGGTGGTTCTCAGGAGTACGAGATGAAGAATGTATTTACTCGGTTCGCGAATGACGTTATCGCAACGTGTGCATTTGGTATTAAAGTGGACTCCCTACGTAACGCCGAAAATGACTTCTACGAGAACGGTAGGAAAATGATGATGTTCCAGAGACCGATTGTCATGGTAAAAGTATTTGGTTTCCGGTTGGCACCCAAGTTGATGGCATGGTTAGGACTGGATTTGTTCGATCGTGAGCAGAACAAGTATTTCACTGAAATCATTAAGGATACGGTGCGAACGCGAGACGCTCATGGAATCGTCCGACACGACATGGTGAACCTGTTGATGCAGGCCCGTAAGGGAGCATTGAAAAATCAAAAGGAAGCAAAAGAGGAAGAAGAAGTCAAGGGGTTCGCCACCGTCGAGGAATCGGAAGTCGGCCGAGTTCAAGTTGGCAAAGGCATGCAGATGTCTGAGGCGGAGATGGTAGCGCAGTGTCTTATCTTTTTCATCGCCGGGTTTGATACCGTTTCCACCTGTTTGACATTCTTGGTGTACGAGTTGACAATCAACCGGGAGGTACAAGATAAGCTGTACGAGGAGATATGCGAAACAAAAACCACCCTCGGGGGAGGTCCATTGACGTATGATGCCGTGCAGAAGATGCAGTACCTGGACATGGTTGTTTCGGAAGGCCTGCGAATGTGGGCACCGGCTCCTTCCACGGATCGATTGTGCGTCCGGGATTATGTGGTGGATGATGGGGAGAATCTCAAATTCACCATTGACAAAGGCACGGCAGTGTTCTTCCCCATCGCAGGACTTCACCACGATCCAAAATACTATCCAAATCCGTATAAGTTTGACCCGGAGCGTTTCAGTCCGGAAAATCGCGACAAAATTAATCCGAGTACGTATCTTCCTTTTGGAATCGGACCCAGAAATTGCATTGGATCCCGGTTTGCCCTCATGGAGGTAAAGGCGATCATCTACTACATGCTGATGGAGTTTACGTTCGAAAGGACATCAAACACTCAGGTACCACTACAGTTGGGCAGAGGTTTTGCAGGGATGCGAAGTGAGAAGGGAGTGCATATAGAACTACGGCCACGAAAACATTAATCGGATTCTTATTGTAAATATAAATGGTTAATAAATCAAATTGCGAAATGATGATGGTCTATGAAAAAGGTTTAGTAAGTTGCCTTTCCTTTGATCACTGCCCATTTGAAACAGTTCCGACTTTGTCATAAGGTATCGGAATTACCTTCAGCAGTTCTAAAAGATGTAACCTTAGCGGGTAAGGCAGCACTTGGCCCACAAAATACAATAATTTGTGCTGATAAGCTAATTGTTATTCTTGTGACAACAATCAGCTAAGATAAGAAAAGCAATTGCGTTATCTTTTATTTTGAGAAACCCTCCAATCGACAGAAGTACATCGAAGAGTTTGAGGGACTTTTTTATTTTTTATTTACTCCCAAATTTCAACACGGGCCACTAACTTCACTAACACGAATACGCTTCCATACCGGTTTTTATAAATATAAGCATAGGCTTGGGTGGGGGTATTAAAGATTGTTGATTGACGCTTCAACATTCGCTTTTCGAACAGCCCTGTAGATGCTGCGTCGTGTGTGTTGTTACATGCATTTACCACCTCCATCGGATCTTCAAATCTGCTTGTCATCATCGCAAATCATCGTATTTTTTACTTCAAATTGTTTGGCCGTTTGACTGCGGCAGAGATTCTCAAGCTCTTTTTGGTTTTACTCGTTTGATATGTGGGAAGATTAGTGAAATAAGATTTTCCTATTTCGAAATGGTTGTTCAATGATGATGATTAGGTTCATATGATGATAGTTCACTGAGCGTAGTGGGGTAATTTATTTCGTGTAGTTTGAGAAGCACTGACATTACATATTACATGCCCACTCACTCCTCTGTATGAAATATTCTTATCACTCTCTGTCCGAATTGTGTTGAAGATATACGCAACGGCCCCTGTTGAAATACGCTATAAAAGACCTCTTCCGTGATCAACACAATTCAGTTGGATTGTAAAATTTGCCAGAGTGAGTGAGATCCGTAGCTAACAACAGAGGAATTAAAGAGGTAGCTTGTAGTTTGAAATAATTGGCCATATCCACACATTAAGAACATGGAGATCGATCTGGTGTACCTTTTGCCATTGTTGGCGATCCTGTACACAGTCTACTATTACCTTACGAAGGATAACAAATACTTCCATGATAAGCCGATACCTTCGATGGCGGTGCAGCCTCTGTTTGGAAGCTCTGGCCGGTTGATGATGAAAAAGACCTCGTTTCACGAGTGGATCATCGAAATCTACAACAAGTATCCGTTGGTGAAGTAAGTGCAATTTTCATTTAAATGCAAAATATAATGTTAAAAAGCACTTTCTTTTGAATGCATCTCCCTATAGAGTGTTCGGAATGCATGACTTTACTGCACCGGTGTTCGTCGTTCGCGATCCAGAGTTGATCAAGCGAATCGGCGTGAAGGATTTTGATTACTTTGTCAACCACCGACCGATTTTCGGTACTTCCGAGGTCACCAACTCGCACTCGCTGTTCAATAAAACGTTGATCGCGCTTAACGATCAAAAGTGGAGGGATATGAGGGCCACCCTTAGTCCTGCCTTCACAGGAAGTAAAATGCGGCAGATGTTCGAACTGGTTGGTGAATGTTGTGAGAATATGGTGAAGTTCTATAAAGATGAAGTGCGCACTAAAGGTGGTTCACAGGAGCACGAGATGAAGAATGTATTCACTCGGTTCGCGAATGACGTTATCGCAACGTGTGCATTTGGTATCAAAGTGGACTCTCTGCGAAATGCCGAGAATGACTTCTATGAAAACGGTAGGAAAATGATGATGTTTCAGAGGCCAATTGTCATGGCGAAAGTATTTGGCTTCCGATTGGCACCGAAGTTAATGGCATGGTTGGGACTGGATTTGTTTGATCGTGAGCAGAACAAGTATTTCACCGAGATTATCAAGGATACTGTGCGAACGCGAGACGCTCATGGAATCGTCCGACACGACATGGTGAACCTGTTGATGCAGGCTCGTAAGGGAGCATTGAAAAATCAAAAGGAAACCAAGGAGGAAGAGGAAGTGAAAGGCTTCGCCACTGTTGAAGAATCGGAAGTCGGCCGAGTGCAAGTCGGCAAAGGAATGGAGATGTCCGAGCTTGAAATGGTGGCCCAATGTCTTATCTTTTTCCTCGCCGGGTTTGATACCGTTTCCACCTGTTTGACGTTCCTGGCGTATGAGTTGACCGTCAACCGGGAGGTACAAGATAAGCTGTACGAGGAGATACGTCAGACAAAGGAATCGCTTGGTGGGGGTCCACTGACCTACGATGCCGTCCAAAAGATGCCATACATGGACATGGTTGTCTCGGAAGGCCTGCGAATGTGGTCACCGGCTCCTTCCACTGATCGATTGTGCGTCCGGGATTATGTGGTGGATGATGGGGAGAATCTCAAATTCACCATCGATAAAGGCACGGCAGTATTCTTCCCCATTGCAGGACTTCACCACGATCCAAAATACTATCCAAACCCGAACAAGTTTGACCCGGAGCGTTTCAGTCCGGAAAATCGTGACAAAATTAATCCGAGTACGTATCTTCCTTTTGGAATCGGACCAAGAAACTGTATTGGATCTCGCTTTGCCCTCATGGAAGTTAAGGCGATCATCTACTACATGCTGATGGAGTTTACGTTCGAGAAAACATCAAACACTCAAATACCTCTACAGTTGGGCAAAGGTTTTGCAGGGATGCGCAGTGAGAAGGGGGTACATGTAGAACTGCGGCCAAGAAAACATTGA
Ortholog: Anopheles gambiae | AGAP012296-PA | ortholog many-one
Aedes aegypti | AAEL002633-PA | ortholog many-many
Aedes aegypti | AAEL002638-PA | ortholog many-many
Aedes aegypti | AAEL014603-PA | ortholog many-many
Aedes aegypti | AAEL014606-PA | ortholog many-many
Aedes aegypti | AAEL014607-PA | ortholog many-many
Aedes aegypti | AAEL014609-PA | ortholog many-many
Aedes aegypti | AAEL014610-PA | ortholog many-many
Aedes aegypti | AAEL014613-PA | ortholog many-many
Aedes aegypti | AAEL014615-PA | ortholog many-many
Aedes aegypti | AAEL014616-PA | ortholog many-many
Aedes aegypti | AAEL014617-PA | ortholog many-many
Aedes aegypti | AAEL017366-PA | ortholog many-many
Culex quinquefasciatus | CPIJ003082-PA | ortholog many-many
Culex quinquefasciatus | CPIJ005332-PA | ortholog many-many
Culex quinquefasciatus | CPIJ010203-PA | ortholog many-many
Culex quinquefasciatus | CPIJ010544-PA | ortholog many-many
Culex quinquefasciatus | CPIJ010545-PA | ortholog many-many
Culex quinquefasciatus | CPIJ010546-PA | ortholog many-many
Culex quinquefasciatus | CPIJ010547-PA | ortholog many-many
Culex quinquefasciatus | CPIJ010548-PA | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
GO:0004497:monooxygenase activity
KEGG: Orthology:K07424
Pathway name:Linoleic acid metabolism
Pathway map:ko00591
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Down -4.26461506 1.26E-126 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810
Transcriptomics Female/Male Adult Up 1.19379830 0.0026292149 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810