ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB49806.1'
Gene ID: ZHAS_00017824
Protein ID: KFB49806.1
Description: cytochrome P450, CYP 9J55
Location: KE525347.1:1464872:1466585:reverse strand[JBrowse]
Sequence: >ZHAS_00017824  (1626 bp)    All exons in this region
ATGGCGGTTGACATGGTAACGGTGGCGGCGTTGGTCGCCATAGTGGCGTTGGTGTACTACTATGTGCAGAAAAAGTACCAGTACTTCCTCGACAAGCCGTATCCGCATCTAAAGCCTACCTTCTTGGTGGGCAGTGGAGGTCCCATGCTTTTCCGACGGCGCGACATGATGGAGCACATTAACGTGCTGTACAACAGCTTTCCGGATGCCAAGTAAGTGCTGTCGGGAGTTCAAAGCTCAGGTGTGGAAGGGTTGAAGTGGTTCTCAATGAAGTATTTTGTTTACTTGTCCAAATATAAGGATAATGGGTGCGTACGATTGCCTCACACCAAACCTGATGATACGCGATCCAGAAACGCTAAAACAGATTGCGGTCAAAGACTTTGACTATTTCACCGACCACACACCGTTCGTGCCGAATGAGAAGGATGTGATGCAGAGTGACAACATGTTCCTCAACTCGCTGTTCATGCTGCGGGGACAAAAGTGGCGCGACATGCGGGCCACCCTCAGCCCGGCCTTCACCGGAAGCAAGATGCGGCAGATGTTCGAGCTGGTGTCGGAAAGTGGACAGGGTATGGTGCAGCACCTTCTCGCCGAAGCGCGCCGCGACGGAGCCACGCAGCAGTACGAAATGAAGGACATTTTCTCCCGCTTCGCCAACGATGTGATCGCCTCCGTGGCGTTCGGGATTCAGGTGAACTCTTTCACCGAGCCGAAGAACGATTTCTACACCAAGGGTAAAAAGCTGCTGGATTTTAACTCGTTCATGTCGAGCGTCAAGTTCCTGCTGTTCATTACCGTGCCACGATTAATGCTGAAGCTGAACATCGAGCTTATGGATGCGGTCCTCTGTAAGCACTTCCACGAGATGATTCTCGATAACATGCGAGTGCGTGACGAGAAAGGAATCGTGCGAAACGATATGATCAACATACTGATGCAAGTGAAAAAGGGAGCCCTACGGCATCAGAAGGAAGAGGTCGACACAAAGGATGCCGGATTTGCGACGGTAGAGGAATCGACCGTGGGCAAATCGGCGATCACACGTCAGTGGTCCGACAAGGAACTGGTGGCTCAGTGCTTCCTGTTCTTCCTGGCCGGCTTCGACACCGTATCCACCGCACTCGGCTTCCTGTGCTACGAGCTAACGATGCACCCCGATGTGCAGGAGCAACTATATCGCGAAATTTGCGAGGTGGACCAGTCTCTAGAGGGAAAACCACTGACCTACGATGCGGTCCAGGCGATGCGCTACATGGACATGGTAGTGTCGGAGACGCTGCGCATCTGGCCACCGGCACCAGCAGTCGACCGGTACTGCAACCGAGACTACACCTTCGACGATGGCGAGGGACTTCGGTTCAAGATCGAAAAGGGTCGTACCATTTTTATTCCGATTTCAGGATTGCATAGCGATCCGAAGTACTTTCCCAATCCGAAAAAGTTTGATCCAGAGCGATTCAGCGAGGAAAACCGACACAATATCAACCCAGGAGCGTACCTGCCGTTCGGAATCGGTCCACGCAATTGCATCGGCTCACGCTTTGCCCTGATGGAGGTGAAATCGATCGTGTACTATATGCTGAAGAGCTTCACGTTCGAGCGATGCGAGAAAACACAAGTGCCGCTGAAGCTGAAGAAGAATCCGGCCGCGATAAGCACCGAGAAGGGTATCTGGATTCGCCTGAAGCCGAGGGAGGTCAACAACTGA
Ortholog: Anopheles gambiae | AGAP012292-PA | ortholog one-one
Aedes aegypti | AAEL006784-PA | ortholog one-many
Aedes aegypti | AAEL006793-PA | ortholog one-many
Aedes aegypti | AAEL006798-PA | ortholog one-many
Aedes aegypti | AAEL006804-PA | ortholog one-many
Aedes aegypti | AAEL006805-PA | ortholog one-many
Aedes aegypti | AAEL006810-PA | ortholog one-many
Aedes aegypti | AAEL006811-PA | ortholog one-many
Aedes aegypti | AAEL006814-PA | ortholog one-many
Aedes aegypti | AAEL006815-PA | ortholog one-many
Aedes aegypti | AAEL009699-PA | ortholog one-many
Aedes aegypti | AAEL014604-PA | ortholog one-many
Aedes aegypti | AAEL014605-PA | ortholog one-many
Aedes aegypti | AAEL014608-PA | ortholog one-many
Aedes aegypti | AAEL014611-PA | ortholog one-many
Aedes aegypti | AAEL014614-PA | ortholog one-many
Aedes aegypti | AAEL014618-PA | ortholog one-many
Culex quinquefasciatus | CPIJ010537-PA | ortholog one-many
Culex quinquefasciatus | CPIJ010538-PA | ortholog one-many
Culex quinquefasciatus | CPIJ010539-PA | ortholog one-many
Culex quinquefasciatus | CPIJ010540-PA | ortholog one-many
Culex quinquefasciatus | CPIJ010541-PA | ortholog one-many
Culex quinquefasciatus | CPIJ010542-PA | ortholog one-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: Orthology:K15003
Pathway name:
Pathway map:NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Up 0.14347881 0.6718558515 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810