ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB49807.1'
Gene ID: ZHAS_00017825
Protein ID: KFB49807.1
Description: cytochrome P450, CYP 9J56
Location: KE525347.1:1468045:1472615:reverse strand[JBrowse]
Sequence: >ZHAS_00017825  (1644 bp)    All exons in this region
ATGGAGATAAGTCTGCTAACGTTGTCCCTAGTGGTCGGTTTGTTCGTGCTGGCGTATCGATATTTAACGAAAAACTACTTCTACTTTGCCGACAAACCAATTCCGTCGATGAAGCCCACGATTCTGTTCGGCAATGCGGGCCCACTGCTTATGAAGAAGGTGGATCTTTTCGAACACTTTAGGAACATTTACGACACCTTTCCGAACGCAAGGTAAGTTATCCGAGTCGAACAGAACAAGTGTAGGGTTATTGCTTGAATACCCAATGTACCCCTCAGAAAGAACTAACATAGAACTCTTGCATTCTCTTTCTAATATGAAGAATTTTTGGTACGTTCAACTTGCGGCAGCCGGCGTACGTCGTACGTGATCCTGACGTGGCGAAGCAAATCACTGTGAAGGACTTTGACCACTTTGCCGACCACATGAAGACTGGATTGGAGTCGGACGATGACAACGGGCACAACGATCTGCTTTTGACTAACTCACTCGTGTCACTGCGAGGACAGAAATGGCGCGATATGCGGGCCACACTCAGTCCGGCCTTTACCGGTAGCAAGATGCGCCAGATGTTTTCCCTTATCGCCGAGTGTGGCCAGTCGATGGTGACGCACTTCCGTGCGGAGGAGCAGAAGGCCATCGCTGGGGGTGCGTCCGGGCTGCAGCTGGAAATGAAGGACGTGATGCAGCGTTTCGCCAACGACGTGATCGGAACGGCCGCTTTCGGCATCAAGGTGGACTCGTACCGTGATCCGAACAACGAGTTCATCACCATGGCCCGTTCCGTAACGGACCGGAAGTCACCGATGAAGGTGCTGAAGACGCTGGGATTCGCTTTCGCACCGAAGCTGATGTTACGGCTGAATATCGACCTCCTGACGCCCGAGGAGGATCGGTTCTTCCGCCAGACGATCCTGGAGACGATGCGCACGCGCGAAGAGAAGGGCATCTTCCGACCGGACATGATCCAACTGCTGATGCAGGCAAAGAAGGGCAGTCTGCGACATGCCCAGAAGGCGGAAGAGGCTGGCCAACCGGCTGCGGAAGGTTTTGCTACGGTGGACGAGTCGCAGGTGGGTCGCCGTGCGCATGACCGCGTGTGGACCGACACCGAGCTTGTCTCGCAAGCATTTATCTTCTTCTTCGCCGGCCTTGAGACCATCTCCTGGACGCTCTCGTTTGCGCTCCATGAGCTGGCAGTTGCGGAAGATGTTCAACAACGACTGTTTGAGGAAATCCGTGGCGCCGAGGAGACATTAGAGGAAGGCAAGAGCCTCACCTACGAACAACTCCAGGCCCTTCCCTACCTAGACAATGTGATCTCCGAGACGCTCCGGAAGTGGCCGATCGGCCTCGTTCTGAACAGAGAGTGCATTCGGGACTACCATTACGATGACGGCAAAGGAACGTCGTTCACCATGGAGAAGGGAGCGGTTGTGTTCATACCGATTATCGGTTTGCACTACGATCCGAAGTACTTCCCCAATCCGGAAAGATTCGATCCGGACCGATTCAGCGTGGAAAACCGCAAGAACATACAGAACGGCACCTATCTCCCATTCGGCGCTGGTCCTCGAAATTGCATCGGTAAGTATCACTCACCCTGAGGAGGTTCCAAACTCTACCGTGTGATCACAACATCCATTATTGTTTCTTCCCTTTTCCTAGGTTCCCGGTTTGCACTGATGGAAGCGAAGGCGGTGCTGTACTATCTCCTACTGAACTTCAGTGTACTACCGTGCGAAAAGACACAAATTCCACTGAAGCTGAAAAAATCGTCTGCAGAGTTCGCGACGGAAAAGGGCGTCTGGCTGGAGTTCCAATCACGCAAAAGGTGATCGACCAGCAAAGCAAGGAACGTTTAGTTTTTAGCGACAAACCAGCCTAGTGTAGACCACAGTATTTAAGAATAAACATTATTTATTTACTAAATCCGTTGCGCTGGGATAATTCATTCATGGTACAGACCGCAGTAAGAGAGGAGATACTTTGATCCCCCGTTTCTTCTGTTTGCTATCAACAGAAAATTGCCTCCGGCATAGGAATCAGTTCGGATTTTTTGAACTCTCACTCCCACTGCTGGAGCAGAAGAGGAATGAGTATTATAATTTTCTCGTTTTATATTGCACAAACTTCTCAAAACCTTAACATGCATCTTCTGTGGCAAGTGATGTTATACAGCAAATCGTTGGTCGGCCATTCGTTCTATGGGGGTTTCAAGTTCCAAGGGTGACCTCACGATTTCCACGTGATGTGTTACCTGTAACGATCGTGTCATGTGCAACACGACAATTTTTTGCTGCAATCAATTCATAACATCGCTCATGTTATTTGGTAGCTGTTTGAAATGTCATTTTCACAAAATGCTTGTGCTTTGGTTTGCTAGTTCTGCAAGAAAAAACAGCTACTAAATTGATTAAATTTGCTTCATGGTTAACCAACTAGAGAAAAACAAACGCTGGTCATCTAGGGATGTACGGCATTTTTAAGCTAGTGTGCGTTATCATCCTGAAACCCGAATCGCAGCTACGATACATGGAGTCACTTATAAGGTTGAACATCGTCGCTCCGGCAACGCAGTACGCATTTAGCTACGAAGAAGGGCGTACCACGTCGGTAGTGTTTCGGAGGACAGGCTATTGATCAAAGCAGCCAACTTGAGTGCGGTCAGAAGATAATCTCAATATTCGACGTTCACAAAGTGTGTGTTTACGTGCAGAAATTACAAAACAGTTAGCTATGGAGATAAGCCTGCTAACGTTGTCCCTAGTGGTCGGTTTGTTCGTGCTGGCGTACCGATTCCTCACAAAGAACTACTTCTACTTTGCCGACAAACCAATCCCGTTTATGAAGCCCACGTTTCTGTTCGGCAATGCGGGCCCACTGCTTATGAAGAAGGTGGATCTTTTCGAGCACTTTAGCAACATCTACAATGCTTTTCCAAACTCAAGGTAAGACATCCAAGTAGCCACGATATTTTATGTTTACGCAACCACCGATCTCGTCATGGATAAAATAAATTTAGTTTCTTCATGTATCTTTATTCGTGGTGAAGAATTTTTGGAATGTTCAACTTGCGACAACCGGCGTATATAGTGCGCGATCCAGACGTTGTCAAGCAGATCACAGTGAAGGACTTTGACCACTTTGCCGACCATATGATTACTGGTTTGGAGGCGGACGATAACAACCACAACGATTTGCTGTTCTCCAACTCGCTCGTGTCACTGCGAGGACAGAAATGGCGCGATATGCGGGCCACACTCAGTCCGGCCTTTACCGGTAGCAAGATGCGGCTCATGTTTTCCCTCATTGCCGAGTGTGGCCAGTCGATGGTGACGCACTTCCGTGCGGAGGAGCAGAAGGCCATCAGCGGGGGTGCGTCCGGCCTGCAGCTGGAAATGAAGGATGTGATGCAGCGTTTCGCCAACGACGTGATCGGAACGGCCGCTTTCGGCATCAAGGTGGACTCGTACCGTGATCCGAACAACGAGTTCATCACCATGGCCCGTTCCGTAACGGACCGGAAGTCACCGATGAAGGCGCTGAAGATGCTGGGTTTCACTTTCGCACCGAAACTGATGACGCGGCTGAAGATCGACTTTTTGTCGCTCGAGGAAAACCAATTCTTCCGCCAGACGATCCTGGAGACAATGCGCACGCGCGAAGAAAAGGGCATCTTCCGACCGGACATGATCGAACTGCTGATGCAGGCAAAGAAGGGCAGTCTGCGACATGCCCAGAAGGCGGAAGAGGCTGGCCAACCGGCTGCGGAAGGGTTTGCGACGGTGGACGAGTCGCAGGTGGGTCGCCGTGCGCATGACCGCGTGTGGACCGACACCGAGCTCGTCTCGCAAGCATTTATCTTCTTCTTCGCCGGTTTTGAGACCATCTCCTGGACGCTCTCGTTTGCTCTCCATGAGCTGGCAGTCGCGGAAGACGTTCAGCAGCGACTGTATGAGGAAATCCGTGGCGCCGAGGAGGCATTAGAGGAAGGCAAGAGCCTCACCTACGAACAACTCCAGGCCCTTCCCTACCTGGACAACGTAATCTCTGAGACGCTCCGGAAGTGGCCGATCGCCACGGTGCTGAATCGAGAATGCGTTCGGGAGTACCAATACGATGACGGCAAGGGAACATCGTTCACCATGGAGAAGGGCGCGGTTGTGTTCATACCGATTATCGGTTTCCACTTCGATCCGAAGTACTTCCCCAATCCGGAAAAATTCGATCCGGACCGATTCAGTGTGGAAAACCGCAAGAACATTCAGAACGGCAGCTATCTTCCATTCGGCGCAGGTCCTCGAAATTGCATCGGTAATTATTCCTCTTCCTGAAGAGGTGGCCACTCCAAACTCTACTGTGTGATCACAACATCCATTATTGTTTCTTTCCCTCCAGGTTCCCGGTTTGCACTGATGGAAGCGAAGGCGGTGCTGTACTATCTCCTACTGAACTTCCGTATACTACCGTGCGAAAAGACACAAATTCCACTAAAGCTGAAGAAATCATCTACAGAGTTCGCGACAGAAAAGGGTGTCTGGCTGGAGTTCCAATCACGCAAAAAGTGA
Ortholog: Anopheles gambiae | AGAP012291-PA | ortholog one-one
Aedes aegypti | AAEL006795-PA | ortholog one-one
Culex quinquefasciatus | CPIJ010536-PA | ortholog one-one
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
GO:0004497:monooxygenase activity
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Up 0.73184419 0.1754911185 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Down -2.02201462 0.0150795247 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400