ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB50408.1'
Gene ID: ZHAS_00018435
Protein ID: KFB50408.1
Description: Glutathione S-transferases, Omega
Location: KE525348.1:1286253:1287451:reverse strand[JBrowse]
Sequence: >ZHAS_00018435  (744 bp)    All exons in this region
ATGAGTAACGGAAAACATTTGGCCAAGGGTAAGCAGCAGTGTTAAAATCAACGACCGAATGCGATTGTTAGCCCAATGTTCGGTAAACTCCAAAGCGCCAAGAGGAAGAAACGTCCATGTTTAACCATGGGGTGAGGTATATTTAGCATCGAGTTCGGTGATGTCATCAGTTGATCTTCGATGAGGTATACTAGGGCCTACCTTAACCCACGATGTGGCTGATAAAACAATTATCAGCAAGATAGGAGATGCCTCCGGAGCCCATGGTCTACTTCGATAGGTTAATTGCGAAAGACAATGACTTGTGTGATTTTATTTCCTTGGCCGTTATCGATCGGCGCCGAGACTGTTCCAGAACGCCAATTTTTTGGAAAGTATCTGTCCAGTTAATGAAGTGTTCTTCCTTTCCACTTAGGTTCCACGGCACCGGTTCTGCCCGACGATGGGAAGCTGGTGCTGTACTCGATGCGTTTCTGCCCGTACGCCCAGCGCGTTCACCTGATGCTGGACGCCAAGAAGATCCCGTACCATACCGTCTACATTAACCTGAGCGAGAAACCGGAGTGGTACTTTGAGAAAAATCCCCTCGGCAAGGTGCCCGCCCTGCAGGTACCGGGCAAGGAGGGCGTCACGCTCTACGAATCGCTGGTGCTGGCCGACTACATCGAGGAGGCGTACTCGGCCCAACAGCGCAAGCTGTACCCGATCGATCCGTTCCGGAAGGCGCAGGATCGTATTTTGATCGAGCGCTTCAACGGCGTCATTACGGCCTACTATCGTATCCTGTTTTCCACCGACGGCATCCCGCCGGGCGCGATCACCGAGTTTGGCATTGCGCTGGACGTTTTCGAGAAGGAGCTCAAATCGCGGGGCACGGCGTACTTCGGGGGCGATAAGCCCGGCATGATCGACTACATGATTTGGCCGTGGTGCGAGCGGGTCGATCTGCTGAAGTTTGCGCTCGGCGATAAGTACGAGCTTGATAAGGAACGTTTTGGCAAATTGGTAAGTGCAACAGTGTAGTCCCGGAAATATGTGCCATTTAATCTTAATATCCTTTTTTATTATTACAGCTGCAATGGAGAGATTTGATGGAAAAGGATGAGGCCGTGAAGCAGTCTTTCATCTCGACCGAAAATCACACCAAGTTTTTGCAAAGCCGCAAGAATGGCGAAAATAACTACGATATTTTGGCGTAA
Ortholog: Anopheles gambiae | AGAP005749-PA | ortholog one-one
Aedes aegypti | AAEL017085-PA | ortholog one-one
Culex quinquefasciatus | CPIJ000031-PA | ortholog one-one
Drosophila melanogaster | FBpp0076348 | ortholog one-many
Drosophila melanogaster | FBpp0076349 | ortholog one-many
GO: GO:0005515:protein binding
GO:0004364:glutathione transferase activity
GO:0005737:cytoplasm
GO:0008152:metabolic process
KEGG: Orthology:K00799
Pathway name:Metabolism of xenobiotics by cytochrome P450
Pathway map:ko00980
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Down -3.83618426 2.63E-26 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 1.43320692 4.56E-11 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400